Incidental Mutation 'R8267:Nme7'
ID 639569
Institutional Source Beutler Lab
Gene Symbol Nme7
Ensembl Gene ENSMUSG00000026575
Gene Name NME/NM23 family member 7
Synonyms non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase), nucleoside-diphosphate kinase, D530024H21Rik, Nm23-M7
MMRRC Submission
Accession Numbers

Genbank: NM_178071; MGI: 2449121

Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock # R8267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 164304121-164437725 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 164340775 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 128 (I128V)
Ref Sequence ENSEMBL: ENSMUSP00000141431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086028] [ENSMUST00000191947] [ENSMUST00000193683] [ENSMUST00000193808]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000086028
AA Change: I128V

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083192
Gene: ENSMUSG00000026575
AA Change: I128V

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191947
AA Change: I128V

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141431
Gene: ENSMUSG00000026575
AA Change: I128V

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193683
AA Change: I128V

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141963
Gene: ENSMUSG00000026575
AA Change: I128V

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193808
AA Change: I128V

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141771
Gene: ENSMUSG00000026575
AA Change: I128V

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-metastatic expressed family of nucleoside diphosphate kinases. Members of this family are enzymes that catalyzes phosphate transfer from nucleoside triphosphates to nucleoside diphosphates. This protein contains two kinase domains, one of which is involved in autophosphorylation and the other may be inactive. This protein localizes to the centrosome and functions as a component of the gamma-tubulin ring complex which plays a role in microtubule organization. Mutations in this gene may be associated with venous thromboembolism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mice exhibit hydrocephaly, domed skulls and 50% exhibit situs inversus. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(30)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Acbd3 A G 1: 180,746,848 D379G probably damaging Het
Akp3 A T 1: 87,127,739 T503S unknown Het
Antxr2 T A 5: 97,965,762 probably null Het
Col9a1 A T 1: 24,185,186 T150S unknown Het
Coro1c T C 5: 113,847,575 D287G probably damaging Het
Cox16 T C 12: 81,480,939 T45A probably benign Het
Cux1 A G 5: 136,282,999 L1161P probably damaging Het
Dock10 T C 1: 80,540,328 T1311A probably benign Het
Dopey1 C T 9: 86,514,001 P839S possibly damaging Het
Ehbp1 T A 11: 22,146,562 D334V probably benign Het
Gm11127 A G 17: 36,056,783 V221A possibly damaging Het
Gm35339 C T 15: 76,356,594 A494V Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hmcn1 A G 1: 150,859,254 F169S probably damaging Het
Hmcn2 A G 2: 31,459,179 T4977A probably benign Het
Kcnq5 A T 1: 21,505,385 I279N probably damaging Het
Lnx2 A T 5: 147,029,091 I406N probably damaging Het
Mdn1 T C 4: 32,742,485 Y3908H possibly damaging Het
Olfr1281 A G 2: 111,328,815 Y132C probably benign Het
Olfr1511 A G 14: 52,390,446 F109S probably damaging Het
Optn T C 2: 5,054,651 T19A probably benign Het
Pmch A T 10: 88,091,117 probably benign Het
Rbms3 T C 9: 117,056,755 N141D possibly damaging Het
Reln A G 5: 22,004,112 L1156P probably damaging Het
Rgs6 A C 12: 82,651,895 M23L probably benign Het
Sh3tc1 T C 5: 35,706,407 Y812C probably benign Het
Smap1 T A 1: 23,866,284 K143I probably damaging Het
Thbs1 A T 2: 118,122,513 H868L probably damaging Het
Tnip3 T G 6: 65,605,842 V140G possibly damaging Het
Vmn2r100 T A 17: 19,522,490 C375* probably null Het
Vmn2r19 T C 6: 123,336,262 S764P possibly damaging Het
Vmn2r22 T C 6: 123,638,041 T197A possibly damaging Het
Vmn2r59 T G 7: 42,012,097 T765P probably damaging Het
Vmn2r71 A G 7: 85,615,496 K12R probably benign Het
Vps41 T C 13: 18,810,471 S163P probably benign Het
Zfp382 G C 7: 30,134,504 G527R probably damaging Het
Other mutations in Nme7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Nme7 APN 1 164345430 splice site probably null
IGL01662:Nme7 APN 1 164328297 missense probably benign 0.02
IGL01893:Nme7 APN 1 164345281 missense probably damaging 0.99
2107:Nme7 UTSW 1 164345353 missense possibly damaging 0.94
R0255:Nme7 UTSW 1 164345375 missense probably damaging 1.00
R3545:Nme7 UTSW 1 164385782 missense probably damaging 0.99
R4380:Nme7 UTSW 1 164345238 missense probably benign 0.35
R5177:Nme7 UTSW 1 164380676 nonsense probably null
R7454:Nme7 UTSW 1 164380648 nonsense probably null
R8990:Nme7 UTSW 1 164328333 missense probably damaging 1.00
R9570:Nme7 UTSW 1 164379392 missense probably benign 0.01
R9781:Nme7 UTSW 1 164328321 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCGATATCATCTTTAACACACTCAC -3'
(R):5'- CATCGTGTTCTATACTTGCCATTAGTG -3'

Sequencing Primer
(F):5'- AGATGACTGCTTGGACTC -3'
(R):5'- GCCATTAGTGAAAGAATTTGTTGTG -3'
Posted On 2020-07-28