Incidental Mutation 'R8267:Acbd3'
ID639570
Institutional Source Beutler Lab
Gene Symbol Acbd3
Ensembl Gene ENSMUSG00000026499
Gene Nameacyl-Coenzyme A binding domain containing 3
SynonymsD1Ertd10e, 8430407O11Rik, Pap7, Gocap1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8267 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location180726043-180754204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180746848 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 379 (D379G)
Ref Sequence ENSEMBL: ENSMUSP00000027780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027780]
Predicted Effect probably damaging
Transcript: ENSMUST00000027780
AA Change: D379G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027780
Gene: ENSMUSG00000026499
AA Change: D379G

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ACBP 81 167 3.2e-18 PFAM
coiled coil region 173 252 N/A INTRINSIC
low complexity region 268 305 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Pfam:GOLD_2 394 524 2.5e-73 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is involved in the maintenance of Golgi structure and function through its interaction with the integral membrane protein giantin. It may also be involved in the hormonal regulation of steroid formation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Akp3 A T 1: 87,127,739 T503S unknown Het
Antxr2 T A 5: 97,965,762 probably null Het
Col9a1 A T 1: 24,185,186 T150S unknown Het
Coro1c T C 5: 113,847,575 D287G probably damaging Het
Cox16 T C 12: 81,480,939 T45A probably benign Het
Cux1 A G 5: 136,282,999 L1161P probably damaging Het
Dock10 T C 1: 80,540,328 T1311A probably benign Het
Dopey1 C T 9: 86,514,001 P839S possibly damaging Het
Ehbp1 T A 11: 22,146,562 D334V probably benign Het
Gm11127 A G 17: 36,056,783 V221A possibly damaging Het
Gm35339 C T 15: 76,356,594 A494V Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hmcn1 A G 1: 150,859,254 F169S probably damaging Het
Hmcn2 A G 2: 31,459,179 T4977A probably benign Het
Kcnq5 A T 1: 21,505,385 I279N probably damaging Het
Lnx2 A T 5: 147,029,091 I406N probably damaging Het
Mdn1 T C 4: 32,742,485 Y3908H possibly damaging Het
Nme7 A G 1: 164,340,775 I128V probably benign Het
Olfr1281 A G 2: 111,328,815 Y132C probably benign Het
Olfr1511 A G 14: 52,390,446 F109S probably damaging Het
Optn T C 2: 5,054,651 T19A probably benign Het
Pmch A T 10: 88,091,117 probably benign Het
Rbms3 T C 9: 117,056,755 N141D possibly damaging Het
Reln A G 5: 22,004,112 L1156P probably damaging Het
Rgs6 A C 12: 82,651,895 M23L probably benign Het
Sh3tc1 T C 5: 35,706,407 Y812C probably benign Het
Smap1 T A 1: 23,866,284 K143I probably damaging Het
Thbs1 A T 2: 118,122,513 H868L probably damaging Het
Tnip3 T G 6: 65,605,842 V140G possibly damaging Het
Vmn2r100 T A 17: 19,522,490 C375* probably null Het
Vmn2r19 T C 6: 123,336,262 S764P possibly damaging Het
Vmn2r22 T C 6: 123,638,041 T197A possibly damaging Het
Vmn2r59 T G 7: 42,012,097 T765P probably damaging Het
Vmn2r71 A G 7: 85,615,496 K12R probably benign Het
Vps41 T C 13: 18,810,471 S163P probably benign Het
Zfp382 G C 7: 30,134,504 G527R probably damaging Het
Other mutations in Acbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Acbd3 APN 1 180745105 missense possibly damaging 0.61
R0321:Acbd3 UTSW 1 180752305 missense probably damaging 1.00
R0365:Acbd3 UTSW 1 180738612 missense probably damaging 1.00
R0524:Acbd3 UTSW 1 180747059 small deletion probably benign
R0733:Acbd3 UTSW 1 180752218 missense possibly damaging 0.75
R0884:Acbd3 UTSW 1 180747059 small deletion probably benign
R1074:Acbd3 UTSW 1 180738548 nonsense probably null
R1327:Acbd3 UTSW 1 180733183 missense possibly damaging 0.95
R1352:Acbd3 UTSW 1 180738530 missense probably damaging 1.00
R1820:Acbd3 UTSW 1 180745138 missense probably benign 0.13
R4697:Acbd3 UTSW 1 180721944 unclassified probably benign
R5187:Acbd3 UTSW 1 180736732 nonsense probably null
R5217:Acbd3 UTSW 1 180726373 missense probably benign 0.18
R5368:Acbd3 UTSW 1 180722095 unclassified probably benign
R6018:Acbd3 UTSW 1 180752338 missense possibly damaging 0.88
R7072:Acbd3 UTSW 1 180726369 missense probably benign
R7366:Acbd3 UTSW 1 180734499 missense probably benign 0.41
R7952:Acbd3 UTSW 1 180752338 missense possibly damaging 0.88
R8260:Acbd3 UTSW 1 180738530 missense probably damaging 1.00
R8327:Acbd3 UTSW 1 180738593 missense probably damaging 0.98
X0027:Acbd3 UTSW 1 180747030 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TAACCTGAGAAGCCTTTCTGTTCC -3'
(R):5'- ACTGGACTCACTGACATGCAC -3'

Sequencing Primer
(F):5'- CCTCCATCCTTGGTCTGAGCTAG -3'
(R):5'- CACTGACAGCAGCATTTGG -3'
Posted On2020-07-28