Incidental Mutation 'R8267:Olfr1281'
ID639573
Institutional Source Beutler Lab
Gene Symbol Olfr1281
Ensembl Gene ENSMUSG00000095156
Gene Nameolfactory receptor 1281
SynonymsGA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8267 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111326520-111332852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111328815 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 132 (Y132C)
Ref Sequence ENSEMBL: ENSMUSP00000087798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090326]
Predicted Effect probably benign
Transcript: ENSMUST00000090326
AA Change: Y132C

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000087798
Gene: ENSMUSG00000095156
AA Change: Y132C

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 301 2.6e-6 PFAM
Pfam:7tm_1 41 287 4.8e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Acbd3 A G 1: 180,746,848 D379G probably damaging Het
Akp3 A T 1: 87,127,739 T503S unknown Het
Antxr2 T A 5: 97,965,762 probably null Het
Col9a1 A T 1: 24,185,186 T150S unknown Het
Coro1c T C 5: 113,847,575 D287G probably damaging Het
Cox16 T C 12: 81,480,939 T45A probably benign Het
Cux1 A G 5: 136,282,999 L1161P probably damaging Het
Dock10 T C 1: 80,540,328 T1311A probably benign Het
Dopey1 C T 9: 86,514,001 P839S possibly damaging Het
Ehbp1 T A 11: 22,146,562 D334V probably benign Het
Gm11127 A G 17: 36,056,783 V221A possibly damaging Het
Gm35339 C T 15: 76,356,594 A494V Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hmcn1 A G 1: 150,859,254 F169S probably damaging Het
Hmcn2 A G 2: 31,459,179 T4977A probably benign Het
Kcnq5 A T 1: 21,505,385 I279N probably damaging Het
Lnx2 A T 5: 147,029,091 I406N probably damaging Het
Mdn1 T C 4: 32,742,485 Y3908H possibly damaging Het
Nme7 A G 1: 164,340,775 I128V probably benign Het
Olfr1511 A G 14: 52,390,446 F109S probably damaging Het
Optn T C 2: 5,054,651 T19A probably benign Het
Pmch A T 10: 88,091,117 probably benign Het
Rbms3 T C 9: 117,056,755 N141D possibly damaging Het
Reln A G 5: 22,004,112 L1156P probably damaging Het
Rgs6 A C 12: 82,651,895 M23L probably benign Het
Sh3tc1 T C 5: 35,706,407 Y812C probably benign Het
Smap1 T A 1: 23,866,284 K143I probably damaging Het
Thbs1 A T 2: 118,122,513 H868L probably damaging Het
Tnip3 T G 6: 65,605,842 V140G possibly damaging Het
Vmn2r100 T A 17: 19,522,490 C375* probably null Het
Vmn2r19 T C 6: 123,336,262 S764P possibly damaging Het
Vmn2r22 T C 6: 123,638,041 T197A possibly damaging Het
Vmn2r59 T G 7: 42,012,097 T765P probably damaging Het
Vmn2r71 A G 7: 85,615,496 K12R probably benign Het
Vps41 T C 13: 18,810,471 S163P probably benign Het
Zfp382 G C 7: 30,134,504 G527R probably damaging Het
Other mutations in Olfr1281
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02426:Olfr1281 APN 2 111328575 missense probably damaging 1.00
IGL02550:Olfr1281 APN 2 111328500 missense probably damaging 1.00
IGL02553:Olfr1281 APN 2 111328988 missense probably benign
IGL02719:Olfr1281 APN 2 111329245 nonsense probably null
IGL02750:Olfr1281 APN 2 111329288 missense probably damaging 1.00
IGL02873:Olfr1281 APN 2 111328872 missense probably benign
IGL03252:Olfr1281 APN 2 111328780 nonsense probably null
IGL03375:Olfr1281 APN 2 111328884 missense probably damaging 1.00
R0055:Olfr1281 UTSW 2 111328525 nonsense probably null
R0368:Olfr1281 UTSW 2 111328787 missense probably damaging 0.99
R0497:Olfr1281 UTSW 2 111328830 missense probably benign 0.00
R0505:Olfr1281 UTSW 2 111329328 missense probably benign 0.00
R1557:Olfr1281 UTSW 2 111328619 missense probably damaging 1.00
R1619:Olfr1281 UTSW 2 111328961 missense probably benign 0.02
R1691:Olfr1281 UTSW 2 111328853 missense probably benign 0.03
R2286:Olfr1281 UTSW 2 111328907 missense probably benign 0.01
R4230:Olfr1281 UTSW 2 111329130 missense probably damaging 1.00
R4274:Olfr1281 UTSW 2 111328815 missense probably damaging 0.98
R4305:Olfr1281 UTSW 2 111329298 missense probably null 0.82
R4495:Olfr1281 UTSW 2 111329020 missense probably benign 0.08
R5307:Olfr1281 UTSW 2 111328396 splice site probably null
R6115:Olfr1281 UTSW 2 111329213 missense probably benign 0.03
R6615:Olfr1281 UTSW 2 111329112 missense probably benign 0.00
R7169:Olfr1281 UTSW 2 111328598 missense probably damaging 1.00
R7601:Olfr1281 UTSW 2 111329220 missense probably benign 0.12
R8447:Olfr1281 UTSW 2 111328962 missense possibly damaging 0.81
Z1177:Olfr1281 UTSW 2 111328825 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTGGTGACTTTGGTAGGAAAC -3'
(R):5'- TGCAGGCTAATTTCATCACCAAAG -3'

Sequencing Primer
(F):5'- TGCCTTTCCTCAGTAAATACACC -3'
(R):5'- TTTCATCACCAAAGGAATATCACAG -3'
Posted On2020-07-28