Incidental Mutation 'R8267:Abcf2'
ID639577
Institutional Source Beutler Lab
Gene Symbol Abcf2
Ensembl Gene ENSMUSG00000028953
Gene NameATP-binding cassette, sub-family F (GCN20), member 2
Synonyms0710005O05Rik, Drr3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R8267 (G1)
Quality Score217.468
Status Not validated
Chromosome5
Chromosomal Location24565345-24577467 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CAT to CATAAT at 24576591 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030795]
Predicted Effect probably benign
Transcript: ENSMUST00000030795
SMART Domains Protein: ENSMUSP00000030795
Gene: ENSMUSG00000028953

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
AAA 115 308 1.6e-6 SMART
AAA 427 595 6.32e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding casette proteins transport various molecules across extra- and intracellular membranes. Alterations in this gene may be involved in cancer progression. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 3 and 7. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 A G 1: 180,746,848 D379G probably damaging Het
Akp3 A T 1: 87,127,739 T503S unknown Het
Antxr2 T A 5: 97,965,762 probably null Het
Col9a1 A T 1: 24,185,186 T150S unknown Het
Coro1c T C 5: 113,847,575 D287G probably damaging Het
Cox16 T C 12: 81,480,939 T45A probably benign Het
Cux1 A G 5: 136,282,999 L1161P probably damaging Het
Dock10 T C 1: 80,540,328 T1311A probably benign Het
Dopey1 C T 9: 86,514,001 P839S possibly damaging Het
Ehbp1 T A 11: 22,146,562 D334V probably benign Het
Gm11127 A G 17: 36,056,783 V221A possibly damaging Het
Gm35339 C T 15: 76,356,594 A494V Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hmcn1 A G 1: 150,859,254 F169S probably damaging Het
Hmcn2 A G 2: 31,459,179 T4977A probably benign Het
Kcnq5 A T 1: 21,505,385 I279N probably damaging Het
Lnx2 A T 5: 147,029,091 I406N probably damaging Het
Mdn1 T C 4: 32,742,485 Y3908H possibly damaging Het
Nme7 A G 1: 164,340,775 I128V probably benign Het
Olfr1281 A G 2: 111,328,815 Y132C probably benign Het
Olfr1511 A G 14: 52,390,446 F109S probably damaging Het
Optn T C 2: 5,054,651 T19A probably benign Het
Pmch A T 10: 88,091,117 probably benign Het
Rbms3 T C 9: 117,056,755 N141D possibly damaging Het
Reln A G 5: 22,004,112 L1156P probably damaging Het
Rgs6 A C 12: 82,651,895 M23L probably benign Het
Sh3tc1 T C 5: 35,706,407 Y812C probably benign Het
Smap1 T A 1: 23,866,284 K143I probably damaging Het
Thbs1 A T 2: 118,122,513 H868L probably damaging Het
Tnip3 T G 6: 65,605,842 V140G possibly damaging Het
Vmn2r100 T A 17: 19,522,490 C375* probably null Het
Vmn2r19 T C 6: 123,336,262 S764P possibly damaging Het
Vmn2r22 T C 6: 123,638,041 T197A possibly damaging Het
Vmn2r59 T G 7: 42,012,097 T765P probably damaging Het
Vmn2r71 A G 7: 85,615,496 K12R probably benign Het
Vps41 T C 13: 18,810,471 S163P probably benign Het
Zfp382 G C 7: 30,134,504 G527R probably damaging Het
Other mutations in Abcf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Abcf2 APN 5 24568796 missense possibly damaging 0.95
IGL02867:Abcf2 APN 5 24571151 missense probably benign 0.03
IGL03325:Abcf2 APN 5 24574212 missense probably damaging 1.00
IGL03329:Abcf2 APN 5 24571248 critical splice acceptor site probably null
R0281:Abcf2 UTSW 5 24566564 missense probably damaging 1.00
R0357:Abcf2 UTSW 5 24573465 missense probably benign 0.16
R0815:Abcf2 UTSW 5 24567270 missense probably damaging 1.00
R0835:Abcf2 UTSW 5 24574253 missense probably damaging 0.99
R1793:Abcf2 UTSW 5 24568776 missense probably benign
R2321:Abcf2 UTSW 5 24567253 nonsense probably null
R5006:Abcf2 UTSW 5 24576537 nonsense probably null
R5765:Abcf2 UTSW 5 24573423 missense probably damaging 0.99
R6317:Abcf2 UTSW 5 24569158 nonsense probably null
R6684:Abcf2 UTSW 5 24569139 missense probably damaging 1.00
R6906:Abcf2 UTSW 5 24568842 missense possibly damaging 0.90
R6980:Abcf2 UTSW 5 24565972 missense probably benign 0.01
R8266:Abcf2 UTSW 5 24576591 small insertion probably benign
R8290:Abcf2 UTSW 5 24576591 small insertion probably benign
R8294:Abcf2 UTSW 5 24576591 small insertion probably benign
R8295:Abcf2 UTSW 5 24576591 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAAACTCCCATCTGTGTTTGCC -3'
(R):5'- GGATGGGATAGCACTCAGAC -3'

Sequencing Primer
(F):5'- GGTGTCACCAAAAAGTTTCATGGC -3'
(R):5'- GGATAGCACTCAGACATTCTTACCTG -3'
Posted On2020-07-28