Incidental Mutation 'R8267:Lnx2'
ID 639583
Institutional Source Beutler Lab
Gene Symbol Lnx2
Ensembl Gene ENSMUSG00000016520
Gene Name ligand of numb-protein X 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R8267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 147016655-147076586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 147029091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 406 (I406N)
Ref Sequence ENSEMBL: ENSMUSP00000016664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016664]
AlphaFold Q91XL2
Predicted Effect probably damaging
Transcript: ENSMUST00000016664
AA Change: I406N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016664
Gene: ENSMUSG00000016520
AA Change: I406N

DomainStartEndE-ValueType
RING 51 88 2.06e-6 SMART
low complexity region 103 114 N/A INTRINSIC
PDZ 242 317 2.25e-17 SMART
PDZ 348 421 2.97e-17 SMART
PDZ 474 553 7.37e-13 SMART
PDZ 606 683 1.27e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Acbd3 A G 1: 180,746,848 D379G probably damaging Het
Akp3 A T 1: 87,127,739 T503S unknown Het
Antxr2 T A 5: 97,965,762 probably null Het
Col9a1 A T 1: 24,185,186 T150S unknown Het
Coro1c T C 5: 113,847,575 D287G probably damaging Het
Cox16 T C 12: 81,480,939 T45A probably benign Het
Cux1 A G 5: 136,282,999 L1161P probably damaging Het
Dock10 T C 1: 80,540,328 T1311A probably benign Het
Dopey1 C T 9: 86,514,001 P839S possibly damaging Het
Ehbp1 T A 11: 22,146,562 D334V probably benign Het
Gm11127 A G 17: 36,056,783 V221A possibly damaging Het
Gm35339 C T 15: 76,356,594 A494V Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hmcn1 A G 1: 150,859,254 F169S probably damaging Het
Hmcn2 A G 2: 31,459,179 T4977A probably benign Het
Kcnq5 A T 1: 21,505,385 I279N probably damaging Het
Mdn1 T C 4: 32,742,485 Y3908H possibly damaging Het
Nme7 A G 1: 164,340,775 I128V probably benign Het
Olfr1281 A G 2: 111,328,815 Y132C probably benign Het
Olfr1511 A G 14: 52,390,446 F109S probably damaging Het
Optn T C 2: 5,054,651 T19A probably benign Het
Pmch A T 10: 88,091,117 probably benign Het
Rbms3 T C 9: 117,056,755 N141D possibly damaging Het
Reln A G 5: 22,004,112 L1156P probably damaging Het
Rgs6 A C 12: 82,651,895 M23L probably benign Het
Sh3tc1 T C 5: 35,706,407 Y812C probably benign Het
Smap1 T A 1: 23,866,284 K143I probably damaging Het
Thbs1 A T 2: 118,122,513 H868L probably damaging Het
Tnip3 T G 6: 65,605,842 V140G possibly damaging Het
Vmn2r100 T A 17: 19,522,490 C375* probably null Het
Vmn2r19 T C 6: 123,336,262 S764P possibly damaging Het
Vmn2r22 T C 6: 123,638,041 T197A possibly damaging Het
Vmn2r59 T G 7: 42,012,097 T765P probably damaging Het
Vmn2r71 A G 7: 85,615,496 K12R probably benign Het
Vps41 T C 13: 18,810,471 S163P probably benign Het
Zfp382 G C 7: 30,134,504 G527R probably damaging Het
Other mutations in Lnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02593:Lnx2 APN 5 147033015 missense possibly damaging 0.81
IGL02657:Lnx2 APN 5 147028174 missense probably damaging 1.00
IGL02820:Lnx2 APN 5 147042067 missense probably damaging 0.98
R0051:Lnx2 UTSW 5 147029353 missense probably damaging 0.96
R0389:Lnx2 UTSW 5 147019040 missense possibly damaging 0.51
R0482:Lnx2 UTSW 5 147018961 missense probably damaging 0.99
R1601:Lnx2 UTSW 5 147033519 missense probably damaging 0.99
R1604:Lnx2 UTSW 5 147029325 missense probably benign 0.02
R1647:Lnx2 UTSW 5 147027342 missense probably benign 0.04
R3001:Lnx2 UTSW 5 147019015 missense probably benign 0.00
R3002:Lnx2 UTSW 5 147019015 missense probably benign 0.00
R4734:Lnx2 UTSW 5 147029137 missense probably damaging 1.00
R4960:Lnx2 UTSW 5 147019040 missense probably benign 0.09
R5387:Lnx2 UTSW 5 147028154 missense probably benign 0.00
R5689:Lnx2 UTSW 5 147029151 missense probably damaging 1.00
R5950:Lnx2 UTSW 5 147024350 critical splice donor site probably null
R6161:Lnx2 UTSW 5 147042026 splice site probably null
R6623:Lnx2 UTSW 5 147024487 missense probably damaging 1.00
R7086:Lnx2 UTSW 5 147020178 splice site probably null
R7320:Lnx2 UTSW 5 147020133 missense possibly damaging 0.71
R7701:Lnx2 UTSW 5 147024523 missense probably damaging 1.00
R7887:Lnx2 UTSW 5 147019043 missense probably damaging 1.00
R8153:Lnx2 UTSW 5 147028096 missense probably benign
R8298:Lnx2 UTSW 5 147024517 missense probably benign 0.05
R8384:Lnx2 UTSW 5 147029328 missense probably benign 0.01
R8446:Lnx2 UTSW 5 147033359 missense probably benign
R8971:Lnx2 UTSW 5 147033426 missense probably benign
R9378:Lnx2 UTSW 5 147024370 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACAAGTGCATGGGACCACAG -3'
(R):5'- GCTCGGCATTAAACTAGTCCG -3'

Sequencing Primer
(F):5'- ATGGGACCACAGGCTCTAG -3'
(R):5'- CGAAGGACAGATGAGCCG -3'
Posted On 2020-07-28