Incidental Mutation 'R0691:Piwil1'
ID63959
Institutional Source Beutler Lab
Gene Symbol Piwil1
Ensembl Gene ENSMUSG00000029423
Gene Namepiwi-like RNA-mediated gene silencing 1
SynonymsMIWI
MMRRC Submission 038876-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0691 (G1)
Quality Score115
Status Validated
Chromosome5
Chromosomal Location128702524-128755474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128743307 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Methionine at position 256 (R256M)
Ref Sequence ENSEMBL: ENSMUSP00000142807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086056] [ENSMUST00000195959] [ENSMUST00000200192]
Predicted Effect probably null
Transcript: ENSMUST00000086056
AA Change: R246M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083222
Gene: ENSMUSG00000029423
AA Change: R246M

DomainStartEndE-ValueType
GAGE 1 113 9.14e-25 SMART
Pfam:ArgoL1 228 276 4.6e-8 PFAM
PAZ 278 416 1.04e-76 SMART
Piwi 556 848 6.45e-137 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195959
AA Change: R246M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142386
Gene: ENSMUSG00000029423
AA Change: R246M

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
PAZ 278 416 1.04e-76 SMART
Piwi 556 831 4.99e-111 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200192
AA Change: R256M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142807
Gene: ENSMUSG00000029423
AA Change: R256M

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 57 68 N/A INTRINSIC
Blast:PAZ 214 280 5e-23 BLAST
PAZ 288 426 8e-81 SMART
Meta Mutation Damage Score 0.2966 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIWI subfamily of Argonaute proteins, evolutionarily conserved proteins containing both PAZ and Piwi motifs that play important roles in stem cell self-renewal, RNA silencing, and translational regulation in diverse organisms. The encoded protein may play a role as an intrinsic regulator of the self-renewal capacity of germline and hematopoietic stem cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male sterility due to a block in spermatogenesis beginning at the round spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,253 D865G possibly damaging Het
Acy1 A T 9: 106,435,871 probably null Het
Adcy4 A T 14: 55,772,647 probably benign Het
Anpep T G 7: 79,839,299 D347A probably damaging Het
Arhgap28 C T 17: 67,896,164 probably null Het
Ccdc32 A G 2: 119,027,129 probably benign Het
Cdc42bpa A G 1: 180,144,835 T1401A possibly damaging Het
Celsr2 A G 3: 108,412,623 Y958H probably damaging Het
Cenpe A G 3: 135,217,305 E137G probably damaging Het
Chd8 T C 14: 52,213,433 D1399G probably damaging Het
Cntn3 T C 6: 102,168,947 T978A possibly damaging Het
Col10a1 A G 10: 34,395,696 T555A possibly damaging Het
Crybg3 A C 16: 59,565,211 probably null Het
Cts7 A G 13: 61,355,734 F139L probably damaging Het
Dera T C 6: 137,796,747 probably benign Het
Dgka A G 10: 128,723,260 probably benign Het
Dhrs7 T A 12: 72,652,351 I286F probably damaging Het
Dtwd2 A G 18: 49,728,357 probably benign Het
Fam160b2 T C 14: 70,588,287 D351G probably damaging Het
Fermt1 A G 2: 132,906,733 S657P probably damaging Het
Flnb T C 14: 7,890,810 V564A probably benign Het
Garnl3 A G 2: 33,085,907 F16L probably damaging Het
Gck T C 11: 5,906,691 R191G probably damaging Het
Gucy1b1 A T 3: 82,045,634 probably benign Het
Ifna2 A C 4: 88,683,658 L41R probably damaging Het
Krt33a T G 11: 100,012,715 E197A probably damaging Het
Lce1e G A 3: 92,707,756 R95C unknown Het
Lct G T 1: 128,308,234 S345R probably benign Het
Lrp2 A T 2: 69,451,380 N3882K probably benign Het
Mcc G T 18: 44,445,860 T652K possibly damaging Het
Mier1 A G 4: 103,139,502 S109G probably benign Het
Nfat5 A G 8: 107,355,605 N469S probably damaging Het
Olfr382 C A 11: 73,516,844 M118I possibly damaging Het
Olfr807 G A 10: 129,755,402 T16I probably damaging Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Sdk2 T C 11: 113,794,920 probably null Het
Sec22b A G 3: 97,912,674 E94G probably damaging Het
Snrnp70 T C 7: 45,387,245 R131G possibly damaging Het
Spata31d1a A G 13: 59,700,385 S1310P possibly damaging Het
Spint1 A G 2: 119,246,467 E344G probably damaging Het
Srrm1 G A 4: 135,324,991 Q141* probably null Het
Tecta A T 9: 42,384,341 L286Q probably damaging Het
Tep1 T A 14: 50,866,844 K198* probably null Het
Tk2 A G 8: 104,231,192 V174A probably benign Het
Txndc5 T C 13: 38,507,896 K165E probably damaging Het
Ubr4 G A 4: 139,423,906 R1884Q probably damaging Het
Vmn2r61 T C 7: 42,300,420 Y755H probably damaging Het
Xrn1 T A 9: 95,973,539 H296Q probably damaging Het
Zar1l A T 5: 150,512,942 V223D probably damaging Het
Other mutations in Piwil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Piwil1 APN 5 128749973 missense possibly damaging 0.95
IGL01783:Piwil1 APN 5 128743826 missense probably benign 0.29
IGL01992:Piwil1 APN 5 128747332 missense probably null 1.00
IGL02079:Piwil1 APN 5 128742003 missense possibly damaging 0.89
IGL02212:Piwil1 APN 5 128750270 missense possibly damaging 0.90
IGL03133:Piwil1 APN 5 128742029 missense probably benign
IGL03352:Piwil1 APN 5 128751072 missense probably benign 0.29
R0032:Piwil1 UTSW 5 128743280 missense probably benign 0.00
R0032:Piwil1 UTSW 5 128743280 missense probably benign 0.00
R0139:Piwil1 UTSW 5 128747323 missense probably damaging 1.00
R0667:Piwil1 UTSW 5 128741478 splice site probably null
R1146:Piwil1 UTSW 5 128747893 missense probably benign
R1146:Piwil1 UTSW 5 128747893 missense probably benign
R1854:Piwil1 UTSW 5 128747839 nonsense probably null
R2126:Piwil1 UTSW 5 128754096 missense probably damaging 0.99
R4878:Piwil1 UTSW 5 128740981 missense probably damaging 0.99
R5068:Piwil1 UTSW 5 128741614 missense probably damaging 0.98
R5413:Piwil1 UTSW 5 128743880 missense possibly damaging 0.80
R5553:Piwil1 UTSW 5 128745501 missense probably benign 0.09
R5936:Piwil1 UTSW 5 128751078 missense probably benign 0.24
R6158:Piwil1 UTSW 5 128747876 nonsense probably null
R7663:Piwil1 UTSW 5 128747433 missense probably benign 0.00
R7772:Piwil1 UTSW 5 128739463 missense probably benign 0.06
Z1177:Piwil1 UTSW 5 128742086 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGCCTGACCTCGCTAGAAGTGATAG -3'
(R):5'- AGATTGCAGACAACGCACTGCC -3'

Sequencing Primer
(F):5'- CCTTGGTGCTAACTGTTCTGAC -3'
(R):5'- GATGGGCCATCTAACATCCTGAG -3'
Posted On2013-07-30