Incidental Mutation 'R8266:1700001O22Rik'
ID639605
Institutional Source Beutler Lab
Gene Symbol 1700001O22Rik
Ensembl Gene ENSMUSG00000044320
Gene NameRIKEN cDNA 1700001O22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8266 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location30794769-30803661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30801242 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 106 (N106Y)
Ref Sequence ENSEMBL: ENSMUSP00000058055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050003]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050003
AA Change: N106Y

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058055
Gene: ENSMUSG00000044320
AA Change: N106Y

DomainStartEndE-ValueType
low complexity region 79 89 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Pfam:DUF4685 164 245 2.7e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G A 14: 8,482,599 Q525* probably null Het
A630073D07Rik C T 6: 132,627,417 D22N probably null Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Ago3 T A 4: 126,376,928 K258* probably null Het
AW146154 G A 7: 41,481,168 R175* probably null Het
BC030867 T A 11: 102,262,220 V569E possibly damaging Het
Bmp8a G A 4: 123,315,833 T354I probably benign Het
C7 T A 15: 5,007,659 D579V probably damaging Het
Cacna1a A G 8: 84,559,219 N831S probably damaging Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cecr6 T C 6: 120,492,232 E508G probably damaging Het
Cep290 A G 10: 100,559,671 K2114E probably benign Het
Chrnb1 T C 11: 69,784,621 *502W probably null Het
Col16a1 G A 4: 130,065,431 V657M unknown Het
Cyp3a25 A T 5: 145,992,986 V191E probably damaging Het
Dmxl1 T C 18: 49,843,811 I80T probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Exoc6 A G 19: 37,577,049 D191G probably benign Het
F5 G T 1: 164,185,124 probably null Het
Foxf2 AGCCTCCTTACTCG AGCCTCCTTACTCGCCTCCTTACTCG 13: 31,626,378 probably benign Het
Foxf2 CTTACTCG CTTACTCGCCTCTTTACTCG 13: 31,626,384 probably benign Het
Foxf2 TTACTCG TTACTCGCCTCCATACTCG 13: 31,626,385 probably benign Het
Gm13102 A T 4: 144,109,112 D450V probably damaging Het
Gm527 T C 12: 64,920,945 L47P probably damaging Het
Gm5849 T C 3: 90,777,851 E9G probably damaging Het
Grik1 A G 16: 87,947,979 Y376H probably benign Het
Isl2 A G 9: 55,544,124 Q187R probably benign Het
Kat6b C T 14: 21,516,845 probably benign Het
Lpar3 C T 3: 146,240,630 T21I probably benign Het
Map4k4 A G 1: 40,011,653 T759A possibly damaging Het
Map7d1 G A 4: 126,238,560 S273L probably damaging Het
Mcm3ap A T 10: 76,476,580 K498* probably null Het
Med13l T G 5: 118,742,109 S1089A probably damaging Het
Mybphl T C 3: 108,377,360 Y308H probably damaging Het
Olfr1394 T A 11: 49,160,525 Y170* probably null Het
Olfr632 T C 7: 103,937,539 V53A probably damaging Het
Pde6a T A 18: 61,258,213 V543E probably damaging Het
Pdilt C T 7: 119,489,381 D466N probably benign Het
Pole T C 5: 110,294,920 V313A probably damaging Het
Ppfia1 T C 7: 144,514,494 R439G possibly damaging Het
Reg1 T A 6: 78,427,359 V72E possibly damaging Het
Reln T A 5: 22,018,087 I983F possibly damaging Het
Rnft2 T A 5: 118,237,558 D42V possibly damaging Het
Rps6ka1 A G 4: 133,863,684 Y350H probably damaging Het
Sec61a2 A G 2: 5,876,839 probably null Het
Sept2 T C 1: 93,501,526 V239A possibly damaging Het
Sigirr T C 7: 141,091,749 T374A unknown Het
Six4 T A 12: 73,108,649 I507F possibly damaging Het
Ska1 T C 18: 74,204,341 I45V probably benign Het
Spink2 T G 5: 77,211,366 R3S unknown Het
Stox2 C T 8: 47,192,025 G800D probably damaging Het
Tmx4 T C 2: 134,639,541 Y154C unknown Het
Vmn2r27 A G 6: 124,191,978 V731A probably benign Het
Wdr72 A T 9: 74,143,492 M89L probably damaging Het
Xirp2 A T 2: 67,508,574 K386N probably damaging Het
Zfp113 C T 5: 138,150,619 V88M probably damaging Het
Zfp609 G T 9: 65,703,714 R656S possibly damaging Het
Other mutations in 1700001O22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:1700001O22Rik APN 2 30797936 missense probably damaging 0.97
IGL02627:1700001O22Rik APN 2 30795765 missense probably damaging 1.00
R1236:1700001O22Rik UTSW 2 30795744 missense probably damaging 1.00
R1879:1700001O22Rik UTSW 2 30796476 missense possibly damaging 0.73
R1971:1700001O22Rik UTSW 2 30796554 missense probably benign 0.35
R2082:1700001O22Rik UTSW 2 30796379 splice site probably null
R2107:1700001O22Rik UTSW 2 30795732 missense probably damaging 1.00
R5196:1700001O22Rik UTSW 2 30796438 missense possibly damaging 0.70
R5821:1700001O22Rik UTSW 2 30796446 missense possibly damaging 0.61
R6282:1700001O22Rik UTSW 2 30800769 missense possibly damaging 0.82
R7192:1700001O22Rik UTSW 2 30796176 missense probably damaging 0.99
R7644:1700001O22Rik UTSW 2 30797954 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TACTCCTAGGGTTATGTGGCGC -3'
(R):5'- GCCTACAAGCCCAAGGGATATC -3'

Sequencing Primer
(F):5'- GCCCGTTGAGATGGAGAC -3'
(R):5'- TGCTGCCAATGCTCGAAG -3'
Posted On2020-07-28