Incidental Mutation 'R8266:Tmx4'
ID639607
Institutional Source Beutler Lab
Gene Symbol Tmx4
Ensembl Gene ENSMUSG00000034723
Gene Namethioredoxin-related transmembrane protein 4
Synonyms2810417D04Rik, Txndc13, 4930500L08Rik, D2Bwg1356e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R8266 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location134594185-134644145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134639541 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 154 (Y154C)
Ref Sequence ENSEMBL: ENSMUSP00000105746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038228] [ENSMUST00000110119] [ENSMUST00000110120]
Predicted Effect probably benign
Transcript: ENSMUST00000038228
SMART Domains Protein: ENSMUSP00000045154
Gene: ENSMUSG00000034723

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 34 134 5.9e-14 PFAM
transmembrane domain 185 207 N/A INTRINSIC
low complexity region 241 255 N/A INTRINSIC
low complexity region 258 279 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110119
AA Change: Y154C
SMART Domains Protein: ENSMUSP00000105746
Gene: ENSMUSG00000034723
AA Change: Y154C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 34 100 5.6e-11 PFAM
transmembrane domain 132 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110120
SMART Domains Protein: ENSMUSP00000105747
Gene: ENSMUSG00000034723

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 34 134 4.2e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, one transmembrane domain and C-terminal ASP/GLU-rich calcium binding domain. Unlike most members of this gene family, it lacks a C-terminal ER-retention sequence. The encoded protein has been shown to have reductase activity in vitro. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,801,242 N106Y possibly damaging Het
4930452B06Rik G A 14: 8,482,599 Q525* probably null Het
A630073D07Rik C T 6: 132,627,417 D22N probably null Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Ago3 T A 4: 126,376,928 K258* probably null Het
AW146154 G A 7: 41,481,168 R175* probably null Het
BC030867 T A 11: 102,262,220 V569E possibly damaging Het
Bmp8a G A 4: 123,315,833 T354I probably benign Het
C7 T A 15: 5,007,659 D579V probably damaging Het
Cacna1a A G 8: 84,559,219 N831S probably damaging Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cecr6 T C 6: 120,492,232 E508G probably damaging Het
Cep290 A G 10: 100,559,671 K2114E probably benign Het
Chrnb1 T C 11: 69,784,621 *502W probably null Het
Col16a1 G A 4: 130,065,431 V657M unknown Het
Crem A T 18: 3,309,535 probably benign Het
Cyp3a25 A T 5: 145,992,986 V191E probably damaging Het
Dmxl1 T C 18: 49,843,811 I80T probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Exoc6 A G 19: 37,577,049 D191G probably benign Het
F5 G T 1: 164,185,124 probably null Het
Foxf2 AGCCTCCTTACTCG AGCCTCCTTACTCGCCTCCTTACTCG 13: 31,626,378 probably benign Het
Fuca2 T A 10: 13,512,889 probably benign Het
Gm13102 A T 4: 144,109,112 D450V probably damaging Het
Gm527 T C 12: 64,920,945 L47P probably damaging Het
Gm5849 T C 3: 90,777,851 E9G probably damaging Het
Grik1 A G 16: 87,947,979 Y376H probably benign Het
Isl2 A G 9: 55,544,124 Q187R probably benign Het
Kat6b C T 14: 21,516,845 probably benign Het
Lpar3 C T 3: 146,240,630 T21I probably benign Het
Map4k4 A G 1: 40,011,653 T759A possibly damaging Het
Map7d1 G A 4: 126,238,560 S273L probably damaging Het
Mcm3ap A T 10: 76,476,580 K498* probably null Het
Med13l T G 5: 118,742,109 S1089A probably damaging Het
Mybphl T C 3: 108,377,360 Y308H probably damaging Het
Olfr1394 T A 11: 49,160,525 Y170* probably null Het
Olfr632 T C 7: 103,937,539 V53A probably damaging Het
Pde6a T A 18: 61,258,213 V543E probably damaging Het
Pdilt C T 7: 119,489,381 D466N probably benign Het
Pole T C 5: 110,294,920 V313A probably damaging Het
Ppfia1 T C 7: 144,514,494 R439G possibly damaging Het
Reg1 T A 6: 78,427,359 V72E possibly damaging Het
Reln T A 5: 22,018,087 I983F possibly damaging Het
Rnft2 T A 5: 118,237,558 D42V possibly damaging Het
Rps6ka1 A G 4: 133,863,684 Y350H probably damaging Het
Sec61a2 A G 2: 5,876,839 probably null Het
Sept2 T C 1: 93,501,526 V239A possibly damaging Het
Sigirr T C 7: 141,091,749 T374A unknown Het
Six4 T A 12: 73,108,649 I507F possibly damaging Het
Ska1 T C 18: 74,204,341 I45V probably benign Het
Spink2 T G 5: 77,211,366 R3S unknown Het
Stox2 C T 8: 47,192,025 G800D probably damaging Het
Usp34 T A 11: 23,486,810 probably benign Het
Vmn2r27 A G 6: 124,191,978 V731A probably benign Het
Wdr72 A T 9: 74,143,492 M89L probably damaging Het
Xirp2 A T 2: 67,508,574 K386N probably damaging Het
Zfp113 C T 5: 138,150,619 V88M probably damaging Het
Zfp609 G T 9: 65,703,714 R656S possibly damaging Het
Other mutations in Tmx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Tmx4 UTSW 2 134600998 splice site probably null
R0033:Tmx4 UTSW 2 134600998 splice site probably null
R0124:Tmx4 UTSW 2 134639720 critical splice donor site probably null
R0311:Tmx4 UTSW 2 134598526 makesense probably null
R0844:Tmx4 UTSW 2 134600008 critical splice donor site probably null
R3804:Tmx4 UTSW 2 134620577 missense probably damaging 1.00
R3964:Tmx4 UTSW 2 134600061 missense possibly damaging 0.81
R3966:Tmx4 UTSW 2 134600061 missense possibly damaging 0.81
R4296:Tmx4 UTSW 2 134598629 missense probably benign 0.00
R6011:Tmx4 UTSW 2 134639836 missense probably damaging 1.00
R6241:Tmx4 UTSW 2 134639505 intron probably benign
R6463:Tmx4 UTSW 2 134620639 missense probably damaging 0.98
R6810:Tmx4 UTSW 2 134620674 missense probably damaging 0.98
R6882:Tmx4 UTSW 2 134644002 missense possibly damaging 0.53
R6912:Tmx4 UTSW 2 134598799 missense probably benign 0.06
R7483:Tmx4 UTSW 2 134639661 missense probably benign 0.01
R7545:Tmx4 UTSW 2 134609505 missense possibly damaging 0.89
R7737:Tmx4 UTSW 2 134639668 missense probably benign 0.00
R7857:Tmx4 UTSW 2 134639662 missense probably benign 0.00
R8177:Tmx4 UTSW 2 134643902 missense probably damaging 1.00
R8473:Tmx4 UTSW 2 134609524 missense probably benign 0.00
Z1177:Tmx4 UTSW 2 134598651 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGTTGCTAAGTGCTCAAGC -3'
(R):5'- AATGTGGTCTATAGATGGGAATGC -3'

Sequencing Primer
(F):5'- AGCACTACCTGTGGAGTACTC -3'
(R):5'- TGGGAATGCTTAGCAACTGC -3'
Posted On2020-07-28