Incidental Mutation 'R8266:Pdilt'
ID639632
Institutional Source Beutler Lab
Gene Symbol Pdilt
Ensembl Gene ENSMUSG00000030968
Gene Nameprotein disulfide isomerase-like, testis expressed
SynonymsPDILT, 1700007B13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R8266 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119486587-119523489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119489381 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 466 (D466N)
Ref Sequence ENSEMBL: ENSMUSP00000033267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033267] [ENSMUST00000208275]
Predicted Effect probably benign
Transcript: ENSMUST00000033267
AA Change: D466N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033267
Gene: ENSMUSG00000030968
AA Change: D466N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
Pfam:Thioredoxin_6 177 362 6e-35 PFAM
Pfam:Thioredoxin 385 489 3.7e-16 PFAM
low complexity region 495 512 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208275
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has has an N-terminal ER-signal sequence, two thioredoxin (TRX) domains with non-classical Ser-Lys-Gln-Ser and Ser-Lys-Lys-Cys motifs, respectively, two TRX-like domains, and a C-terminal ER-retention sequence. The protein lacks oxidoreductase activity in vitro and probably functions as a chaperone. This gene's expression appears to be limited to the testis. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility and abnormal sperm physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,801,242 N106Y possibly damaging Het
4930452B06Rik G A 14: 8,482,599 Q525* probably null Het
A630073D07Rik C T 6: 132,627,417 D22N probably null Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Ago3 T A 4: 126,376,928 K258* probably null Het
AW146154 G A 7: 41,481,168 R175* probably null Het
BC030867 T A 11: 102,262,220 V569E possibly damaging Het
Bmp8a G A 4: 123,315,833 T354I probably benign Het
C7 T A 15: 5,007,659 D579V probably damaging Het
Cacna1a A G 8: 84,559,219 N831S probably damaging Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cecr6 T C 6: 120,492,232 E508G probably damaging Het
Cep290 A G 10: 100,559,671 K2114E probably benign Het
Chrnb1 T C 11: 69,784,621 *502W probably null Het
Col16a1 G A 4: 130,065,431 V657M unknown Het
Crem A T 18: 3,309,535 probably benign Het
Cyp3a25 A T 5: 145,992,986 V191E probably damaging Het
Dmxl1 T C 18: 49,843,811 I80T probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Exoc6 A G 19: 37,577,049 D191G probably benign Het
F5 G T 1: 164,185,124 probably null Het
Foxf2 AGCCTCCTTACTCG AGCCTCCTTACTCGCCTCCTTACTCG 13: 31,626,378 probably benign Het
Fuca2 T A 10: 13,512,889 probably benign Het
Gm13102 A T 4: 144,109,112 D450V probably damaging Het
Gm527 T C 12: 64,920,945 L47P probably damaging Het
Gm5849 T C 3: 90,777,851 E9G probably damaging Het
Grik1 A G 16: 87,947,979 Y376H probably benign Het
Isl2 A G 9: 55,544,124 Q187R probably benign Het
Kat6b C T 14: 21,516,845 probably benign Het
Lpar3 C T 3: 146,240,630 T21I probably benign Het
Map4k4 A G 1: 40,011,653 T759A possibly damaging Het
Map7d1 G A 4: 126,238,560 S273L probably damaging Het
Mcm3ap A T 10: 76,476,580 K498* probably null Het
Med13l T G 5: 118,742,109 S1089A probably damaging Het
Mybphl T C 3: 108,377,360 Y308H probably damaging Het
Olfr1394 T A 11: 49,160,525 Y170* probably null Het
Olfr632 T C 7: 103,937,539 V53A probably damaging Het
Pde6a T A 18: 61,258,213 V543E probably damaging Het
Pole T C 5: 110,294,920 V313A probably damaging Het
Ppfia1 T C 7: 144,514,494 R439G possibly damaging Het
Reg1 T A 6: 78,427,359 V72E possibly damaging Het
Reln T A 5: 22,018,087 I983F possibly damaging Het
Rnft2 T A 5: 118,237,558 D42V possibly damaging Het
Rps6ka1 A G 4: 133,863,684 Y350H probably damaging Het
Sec61a2 A G 2: 5,876,839 probably null Het
Sept2 T C 1: 93,501,526 V239A possibly damaging Het
Sigirr T C 7: 141,091,749 T374A unknown Het
Six4 T A 12: 73,108,649 I507F possibly damaging Het
Ska1 T C 18: 74,204,341 I45V probably benign Het
Spink2 T G 5: 77,211,366 R3S unknown Het
Stox2 C T 8: 47,192,025 G800D probably damaging Het
Tmx4 T C 2: 134,639,541 Y154C unknown Het
Usp34 T A 11: 23,486,810 probably benign Het
Vmn2r27 A G 6: 124,191,978 V731A probably benign Het
Wdr72 A T 9: 74,143,492 M89L probably damaging Het
Xirp2 A T 2: 67,508,574 K386N probably damaging Het
Zfp113 C T 5: 138,150,619 V88M probably damaging Het
Zfp609 G T 9: 65,703,714 R656S possibly damaging Het
Other mutations in Pdilt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Pdilt APN 7 119500444 missense probably damaging 1.00
IGL02102:Pdilt APN 7 119486950 missense probably benign 0.28
IGL02312:Pdilt APN 7 119519667 missense probably benign 0.03
IGL02887:Pdilt APN 7 119498049 missense possibly damaging 0.86
R0670:Pdilt UTSW 7 119500428 missense probably benign 0.03
R0759:Pdilt UTSW 7 119489484 nonsense probably null
R1525:Pdilt UTSW 7 119487994 missense probably damaging 0.99
R1612:Pdilt UTSW 7 119486975 missense possibly damaging 0.95
R1633:Pdilt UTSW 7 119487994 missense probably damaging 1.00
R1848:Pdilt UTSW 7 119489384 missense probably benign 0.02
R3026:Pdilt UTSW 7 119514954 missense probably benign 0.01
R3546:Pdilt UTSW 7 119500488 nonsense probably null
R4406:Pdilt UTSW 7 119495009 missense probably damaging 1.00
R5331:Pdilt UTSW 7 119514924 missense possibly damaging 0.67
R5459:Pdilt UTSW 7 119486935 missense probably benign 0.01
R5771:Pdilt UTSW 7 119494994 missense probably damaging 0.98
R5807:Pdilt UTSW 7 119500543 unclassified probably benign
R6143:Pdilt UTSW 7 119495042 missense probably damaging 1.00
R6456:Pdilt UTSW 7 119500483 missense probably damaging 0.99
R6850:Pdilt UTSW 7 119486959 missense probably damaging 0.98
R7159:Pdilt UTSW 7 119487951 missense probably benign 0.01
R7676:Pdilt UTSW 7 119494997 missense probably damaging 1.00
R8282:Pdilt UTSW 7 119498070 missense probably damaging 1.00
R8437:Pdilt UTSW 7 119514886 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAATGGACTCAAGTTGTATGC -3'
(R):5'- TGGCATCAGCTTCCAGAGTC -3'

Sequencing Primer
(F):5'- TGGACTAGAGCCAAGAATG -3'
(R):5'- GGAGCTGAGAAACATCCTTCTTTTC -3'
Posted On2020-07-28