Incidental Mutation 'R8266:Six4'
ID639647
Institutional Source Beutler Lab
Gene Symbol Six4
Ensembl Gene ENSMUSG00000034460
Gene Namesine oculis-related homeobox 4
SynonymsTrexBF, AREC3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8266 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location73099609-73113456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73108649 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 507 (I507F)
Ref Sequence ENSEMBL: ENSMUSP00000135699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043208] [ENSMUST00000175693]
Predicted Effect probably benign
Transcript: ENSMUST00000043208
SMART Domains Protein: ENSMUSP00000036150
Gene: ENSMUSG00000034460

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
low complexity region 57 80 N/A INTRINSIC
low complexity region 89 98 N/A INTRINSIC
Pfam:SIX1_SD 101 211 1.6e-47 PFAM
HOX 216 278 7.48e-17 SMART
low complexity region 335 348 N/A INTRINSIC
low complexity region 365 378 N/A INTRINSIC
low complexity region 424 437 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 616 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175693
AA Change: I507F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135699
Gene: ENSMUSG00000034460
AA Change: I507F

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 49 72 N/A INTRINSIC
low complexity region 81 90 N/A INTRINSIC
HOX 208 270 7.48e-17 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeobox family, subfamily SIX. The drosophila homolog is a nuclear homeoprotein required for eye development. Studies in mouse show that this gene product functions as a transcription factor, and may have a role in the differentiation or maturation of neuronal cells. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for a targeted null mutation are viable, fertile, and exhibit no apparent abnormalities suggesting compensation by other Six family members. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,801,242 N106Y possibly damaging Het
4930452B06Rik G A 14: 8,482,599 Q525* probably null Het
A630073D07Rik C T 6: 132,627,417 D22N probably null Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Ago3 T A 4: 126,376,928 K258* probably null Het
AW146154 G A 7: 41,481,168 R175* probably null Het
BC030867 T A 11: 102,262,220 V569E possibly damaging Het
Bmp8a G A 4: 123,315,833 T354I probably benign Het
C7 T A 15: 5,007,659 D579V probably damaging Het
Cacna1a A G 8: 84,559,219 N831S probably damaging Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cecr6 T C 6: 120,492,232 E508G probably damaging Het
Cep290 A G 10: 100,559,671 K2114E probably benign Het
Chrnb1 T C 11: 69,784,621 *502W probably null Het
Col16a1 G A 4: 130,065,431 V657M unknown Het
Cyp3a25 A T 5: 145,992,986 V191E probably damaging Het
Dmxl1 T C 18: 49,843,811 I80T probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Exoc6 A G 19: 37,577,049 D191G probably benign Het
F5 G T 1: 164,185,124 probably null Het
Foxf2 AGCCTCCTTACTCG AGCCTCCTTACTCGCCTCCTTACTCG 13: 31,626,378 probably benign Het
Foxf2 CTTACTCG CTTACTCGCCTCTTTACTCG 13: 31,626,384 probably benign Het
Foxf2 TTACTCG TTACTCGCCTCCATACTCG 13: 31,626,385 probably benign Het
Gm13102 A T 4: 144,109,112 D450V probably damaging Het
Gm527 T C 12: 64,920,945 L47P probably damaging Het
Gm5849 T C 3: 90,777,851 E9G probably damaging Het
Grik1 A G 16: 87,947,979 Y376H probably benign Het
Isl2 A G 9: 55,544,124 Q187R probably benign Het
Kat6b C T 14: 21,516,845 probably benign Het
Lpar3 C T 3: 146,240,630 T21I probably benign Het
Map4k4 A G 1: 40,011,653 T759A possibly damaging Het
Map7d1 G A 4: 126,238,560 S273L probably damaging Het
Mcm3ap A T 10: 76,476,580 K498* probably null Het
Med13l T G 5: 118,742,109 S1089A probably damaging Het
Mybphl T C 3: 108,377,360 Y308H probably damaging Het
Olfr1394 T A 11: 49,160,525 Y170* probably null Het
Olfr632 T C 7: 103,937,539 V53A probably damaging Het
Pde6a T A 18: 61,258,213 V543E probably damaging Het
Pdilt C T 7: 119,489,381 D466N probably benign Het
Pole T C 5: 110,294,920 V313A probably damaging Het
Ppfia1 T C 7: 144,514,494 R439G possibly damaging Het
Reg1 T A 6: 78,427,359 V72E possibly damaging Het
Reln T A 5: 22,018,087 I983F possibly damaging Het
Rnft2 T A 5: 118,237,558 D42V possibly damaging Het
Rps6ka1 A G 4: 133,863,684 Y350H probably damaging Het
Sec61a2 A G 2: 5,876,839 probably null Het
Sept2 T C 1: 93,501,526 V239A possibly damaging Het
Sigirr T C 7: 141,091,749 T374A unknown Het
Ska1 T C 18: 74,204,341 I45V probably benign Het
Spink2 T G 5: 77,211,366 R3S unknown Het
Stox2 C T 8: 47,192,025 G800D probably damaging Het
Tmx4 T C 2: 134,639,541 Y154C unknown Het
Vmn2r27 A G 6: 124,191,978 V731A probably benign Het
Wdr72 A T 9: 74,143,492 M89L probably damaging Het
Xirp2 A T 2: 67,508,574 K386N probably damaging Het
Zfp113 C T 5: 138,150,619 V88M probably damaging Het
Zfp609 G T 9: 65,703,714 R656S possibly damaging Het
Other mutations in Six4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Six4 APN 12 73109197 missense probably benign 0.32
IGL02045:Six4 APN 12 73108655 missense probably benign 0.04
IGL02678:Six4 APN 12 73112634 missense probably damaging 1.00
R2473:Six4 UTSW 12 73104175 missense probably benign 0.00
R3409:Six4 UTSW 12 73112883 missense probably damaging 0.98
R3410:Six4 UTSW 12 73112883 missense probably damaging 0.98
R3411:Six4 UTSW 12 73112883 missense probably damaging 0.98
R4175:Six4 UTSW 12 73108831 missense probably damaging 1.00
R4176:Six4 UTSW 12 73108831 missense probably damaging 1.00
R4296:Six4 UTSW 12 73104125 missense probably damaging 1.00
R4303:Six4 UTSW 12 73112540 missense possibly damaging 0.91
R5013:Six4 UTSW 12 73103626 missense probably benign 0.37
R5782:Six4 UTSW 12 73104058 missense probably benign 0.02
R5794:Six4 UTSW 12 73112350 missense possibly damaging 0.82
R6429:Six4 UTSW 12 73103473 missense probably damaging 1.00
R6650:Six4 UTSW 12 73103525 missense probably benign 0.04
R7018:Six4 UTSW 12 73108953 missense probably benign 0.01
R7464:Six4 UTSW 12 73112530 missense possibly damaging 0.89
R7832:Six4 UTSW 12 73112634 missense probably damaging 1.00
R7871:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7872:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7873:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7956:Six4 UTSW 12 73103761 missense possibly damaging 0.83
RF012:Six4 UTSW 12 73103582 frame shift probably null
RF013:Six4 UTSW 12 73103582 frame shift probably null
RF014:Six4 UTSW 12 73103582 frame shift probably null
RF015:Six4 UTSW 12 73103582 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGGAAGATAAAACGCCATTCC -3'
(R):5'- AAGGCATTCAGACAGTGGCC -3'

Sequencing Primer
(F):5'- TTCCCCAGGATGTAAGAAAGTC -3'
(R):5'- ATTCAGACAGTGGCCTCCCAG -3'
Posted On2020-07-28