Incidental Mutation 'R8266:Exoc6'
ID639658
Institutional Source Beutler Lab
Gene Symbol Exoc6
Ensembl Gene ENSMUSG00000053799
Gene Nameexocyst complex component 6
Synonymsmsec15, Sec15l1, 4833405E05Rik, Sec15, hbd
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8266 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location37550418-37683245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37577049 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 191 (D191G)
Ref Sequence ENSEMBL: ENSMUSP00000064332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066439]
Predicted Effect probably benign
Transcript: ENSMUST00000066439
AA Change: D191G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799
AA Change: D191G

DomainStartEndE-ValueType
low complexity region 265 273 N/A INTRINSIC
Pfam:Sec15 456 762 8.1e-109 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,801,242 N106Y possibly damaging Het
4930452B06Rik G A 14: 8,482,599 Q525* probably null Het
A630073D07Rik C T 6: 132,627,417 D22N probably null Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Ago3 T A 4: 126,376,928 K258* probably null Het
AW146154 G A 7: 41,481,168 R175* probably null Het
BC030867 T A 11: 102,262,220 V569E possibly damaging Het
Bmp8a G A 4: 123,315,833 T354I probably benign Het
C7 T A 15: 5,007,659 D579V probably damaging Het
Cacna1a A G 8: 84,559,219 N831S probably damaging Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cecr6 T C 6: 120,492,232 E508G probably damaging Het
Cep290 A G 10: 100,559,671 K2114E probably benign Het
Chrnb1 T C 11: 69,784,621 *502W probably null Het
Col16a1 G A 4: 130,065,431 V657M unknown Het
Crem A T 18: 3,309,535 probably benign Het
Cyp3a25 A T 5: 145,992,986 V191E probably damaging Het
Dmxl1 T C 18: 49,843,811 I80T probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
F5 G T 1: 164,185,124 probably null Het
Foxf2 AGCCTCCTTACTCG AGCCTCCTTACTCGCCTCCTTACTCG 13: 31,626,378 probably benign Het
Fuca2 T A 10: 13,512,889 probably benign Het
Gm13102 A T 4: 144,109,112 D450V probably damaging Het
Gm527 T C 12: 64,920,945 L47P probably damaging Het
Gm5849 T C 3: 90,777,851 E9G probably damaging Het
Grik1 A G 16: 87,947,979 Y376H probably benign Het
Isl2 A G 9: 55,544,124 Q187R probably benign Het
Kat6b C T 14: 21,516,845 probably benign Het
Lpar3 C T 3: 146,240,630 T21I probably benign Het
Map4k4 A G 1: 40,011,653 T759A possibly damaging Het
Map7d1 G A 4: 126,238,560 S273L probably damaging Het
Mcm3ap A T 10: 76,476,580 K498* probably null Het
Med13l T G 5: 118,742,109 S1089A probably damaging Het
Mybphl T C 3: 108,377,360 Y308H probably damaging Het
Olfr1394 T A 11: 49,160,525 Y170* probably null Het
Olfr632 T C 7: 103,937,539 V53A probably damaging Het
Pde6a T A 18: 61,258,213 V543E probably damaging Het
Pdilt C T 7: 119,489,381 D466N probably benign Het
Pole T C 5: 110,294,920 V313A probably damaging Het
Ppfia1 T C 7: 144,514,494 R439G possibly damaging Het
Reg1 T A 6: 78,427,359 V72E possibly damaging Het
Reln T A 5: 22,018,087 I983F possibly damaging Het
Rnft2 T A 5: 118,237,558 D42V possibly damaging Het
Rps6ka1 A G 4: 133,863,684 Y350H probably damaging Het
Sec61a2 A G 2: 5,876,839 probably null Het
Sept2 T C 1: 93,501,526 V239A possibly damaging Het
Sigirr T C 7: 141,091,749 T374A unknown Het
Six4 T A 12: 73,108,649 I507F possibly damaging Het
Ska1 T C 18: 74,204,341 I45V probably benign Het
Spink2 T G 5: 77,211,366 R3S unknown Het
Stox2 C T 8: 47,192,025 G800D probably damaging Het
Tmx4 T C 2: 134,639,541 Y154C unknown Het
Usp34 T A 11: 23,486,810 probably benign Het
Vmn2r27 A G 6: 124,191,978 V731A probably benign Het
Wdr72 A T 9: 74,143,492 M89L probably damaging Het
Xirp2 A T 2: 67,508,574 K386N probably damaging Het
Zfp113 C T 5: 138,150,619 V88M probably damaging Het
Zfp609 G T 9: 65,703,714 R656S possibly damaging Het
Other mutations in Exoc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Exoc6 APN 19 37589876 missense possibly damaging 0.68
IGL01716:Exoc6 APN 19 37682964 missense probably damaging 0.98
IGL02363:Exoc6 APN 19 37608954 missense probably damaging 1.00
IGL02383:Exoc6 APN 19 37578474 missense probably benign
IGL03394:Exoc6 APN 19 37599572 missense probably benign 0.15
australamerican UTSW 19 37598679 critical splice donor site probably null
IGL03046:Exoc6 UTSW 19 37593769 critical splice donor site probably null
R1156:Exoc6 UTSW 19 37682897 missense probably benign 0.05
R1489:Exoc6 UTSW 19 37597120 missense possibly damaging 0.71
R1747:Exoc6 UTSW 19 37639769 splice site probably null
R2125:Exoc6 UTSW 19 37590941 missense probably damaging 1.00
R2863:Exoc6 UTSW 19 37653413 missense probably benign 0.34
R4090:Exoc6 UTSW 19 37571912 missense probably benign
R4666:Exoc6 UTSW 19 37570505 missense probably damaging 0.97
R4674:Exoc6 UTSW 19 37609082 missense probably damaging 1.00
R5382:Exoc6 UTSW 19 37598679 critical splice donor site probably null
R5471:Exoc6 UTSW 19 37599617 missense probably benign 0.30
R5533:Exoc6 UTSW 19 37593770 splice site probably null
R5607:Exoc6 UTSW 19 37578529 missense probably benign 0.01
R5641:Exoc6 UTSW 19 37587633 splice site probably null
R5759:Exoc6 UTSW 19 37573741 nonsense probably null
R5889:Exoc6 UTSW 19 37582245 missense probably damaging 1.00
R6592:Exoc6 UTSW 19 37571912 missense probably benign
R6936:Exoc6 UTSW 19 37571863 missense probably benign 0.00
R6988:Exoc6 UTSW 19 37609091 missense probably damaging 1.00
R7088:Exoc6 UTSW 19 37577010 missense probably damaging 0.99
R7162:Exoc6 UTSW 19 37577118 missense probably damaging 0.97
R7948:Exoc6 UTSW 19 37576974 missense probably benign 0.00
R8525:Exoc6 UTSW 19 37608992 missense possibly damaging 0.53
R8917:Exoc6 UTSW 19 37589912 missense not run
RF009:Exoc6 UTSW 19 37571620 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGAGTGTCTGATTCATTGCC -3'
(R):5'- CTGTCAGAATCCACTCTAGAGGAAG -3'

Sequencing Primer
(F):5'- CATTGCCTGGCCTTGTGTAACG -3'
(R):5'- TCCACTCTAGAGGAAGACCAGG -3'
Posted On2020-07-28