Incidental Mutation 'R8265:Myoz2'
ID639665
Institutional Source Beutler Lab
Gene Symbol Myoz2
Ensembl Gene ENSMUSG00000028116
Gene Namemyozenin 2
Synonymscalsarcin-1, 1110012I24Rik, Fatz-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8265 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location123006206-123035015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123006523 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 219 (F219L)
Ref Sequence ENSEMBL: ENSMUSP00000029761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029761] [ENSMUST00000141588]
Predicted Effect probably benign
Transcript: ENSMUST00000029761
AA Change: F219L

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029761
Gene: ENSMUSG00000028116
AA Change: F219L

DomainStartEndE-ValueType
Pfam:Calsarcin 1 264 1.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141588
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of sarcomeric proteins that bind to calcineurin, a phosphatase involved in calcium-dependent signal transduction in diverse cell types. These family members tether calcineurin to alpha-actinin at the z-line of the sarcomere of cardiac and skeletal muscle cells, and thus they are important for calcineurin signaling. Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mutants show an excess of skeletal muscle fibers and chronically activated hypertrophic gene program despite the absence of hypertrophy. However, stressed null mutants do form cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A G 19: 3,716,568 T52A probably benign Het
Adam9 T C 8: 24,967,186 Y642C probably damaging Het
Atp2c1 T C 9: 105,470,116 E47G probably benign Het
Btbd9 T A 17: 30,334,304 T395S possibly damaging Het
Cacna1s G A 1: 136,092,626 W800* probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Ceacam20 G A 7: 19,974,234 V255M probably damaging Het
Cit C A 5: 115,988,177 L1610M probably damaging Het
Cped1 A G 6: 22,222,427 T729A probably benign Het
D3Ertd254e T C 3: 36,159,528 probably benign Het
Ddx19b A T 8: 111,009,192 V407E probably damaging Het
Dst A G 1: 34,178,522 K1348E probably benign Het
E2f4 T A 8: 105,301,345 S302T probably damaging Het
Eif1 A G 11: 100,320,473 E31G probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Herc1 C T 9: 66,386,704 Q443* probably null Het
Hmgxb3 A G 18: 61,167,338 V222A possibly damaging Het
Hnrnpu A T 1: 178,332,160 I452N unknown Het
Ints1 C G 5: 139,772,164 D260H probably damaging Het
Kdm5a T A 6: 120,406,596 M766K possibly damaging Het
Lama4 G A 10: 39,105,204 C1720Y probably damaging Het
Mei1 C A 15: 82,103,307 Y433* probably null Het
Milr1 A G 11: 106,763,885 K188E probably benign Het
Myo7a A G 7: 98,085,397 F630S probably benign Het
Nt5c1a T C 4: 123,214,160 V212A possibly damaging Het
Olfr585 A G 7: 103,098,097 T119A probably benign Het
Olfr620 A T 7: 103,611,841 C171S possibly damaging Het
Olfr901 T C 9: 38,431,173 V297A probably damaging Het
Pi16 A G 17: 29,326,973 T242A probably benign Het
Pigw C A 11: 84,880,021 probably benign Het
Pipox T A 11: 77,883,967 T97S probably benign Het
Plagl1 C A 10: 13,128,881 A631E unknown Het
Poteg T A 8: 27,494,895 H427Q possibly damaging Het
Prdm14 A G 1: 13,114,394 S518P probably damaging Het
Rabep2 A G 7: 126,444,251 E441G probably benign Het
Rasal3 A G 17: 32,395,820 probably null Het
Rbm33 T C 5: 28,394,324 V90A Het
Sidt1 C A 16: 44,267,887 R381M possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srsf5 A G 12: 80,947,336 D51G possibly damaging Het
Taar8a T A 10: 24,076,941 S148T probably damaging Het
Tmem59l A G 8: 70,485,776 S149P probably damaging Het
Trafd1 T A 5: 121,373,277 I493F possibly damaging Het
Trrap C T 5: 144,785,534 S289L possibly damaging Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Other mutations in Myoz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Myoz2 APN 3 123016544 splice site probably benign
IGL01417:Myoz2 APN 3 123006432 missense possibly damaging 0.65
IGL01645:Myoz2 APN 3 123034232 missense probably damaging 1.00
IGL01759:Myoz2 APN 3 123013781 missense possibly damaging 0.95
IGL03167:Myoz2 APN 3 123006490 nonsense probably null
R1384:Myoz2 UTSW 3 123026116 missense probably damaging 1.00
R1789:Myoz2 UTSW 3 123026127 missense probably damaging 1.00
R1874:Myoz2 UTSW 3 123026116 missense probably damaging 1.00
R1875:Myoz2 UTSW 3 123026116 missense probably damaging 1.00
R2137:Myoz2 UTSW 3 123034212 missense probably benign 0.00
R3881:Myoz2 UTSW 3 123013720 missense probably damaging 0.98
R6730:Myoz2 UTSW 3 123016627 missense probably damaging 0.98
R8548:Myoz2 UTSW 3 123034267 start codon destroyed possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TGTGCAGAACTTCCTGTGGC -3'
(R):5'- AAGATGCTTGGTCCTGTGGC -3'

Sequencing Primer
(F):5'- AGAACTTCCTGTGGCATCCC -3'
(R):5'- TTGGAGACTATTAGAACAGGTCC -3'
Posted On2020-07-28