Incidental Mutation 'R0691:Gck'
ID 63969
Institutional Source Beutler Lab
Gene Symbol Gck
Ensembl Gene ENSMUSG00000041798
Gene Name glucokinase
Synonyms Gls006, hexokinase 4, HK4, MODY2, Hlb62
MMRRC Submission 038876-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0691 (G1)
Quality Score 117
Status Validated
Chromosome 11
Chromosomal Location 5850820-5900081 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5856691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 191 (R191G)
Ref Sequence ENSEMBL: ENSMUSP00000105448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102920] [ENSMUST00000109822] [ENSMUST00000109823]
AlphaFold P52792
Predicted Effect probably damaging
Transcript: ENSMUST00000102920
AA Change: R191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099984
Gene: ENSMUSG00000041798
AA Change: R191G

DomainStartEndE-ValueType
Pfam:Hexokinase_1 10 217 4.3e-80 PFAM
Pfam:Hexokinase_2 219 458 1.3e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109822
AA Change: R191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105447
Gene: ENSMUSG00000041798
AA Change: R191G

DomainStartEndE-ValueType
Pfam:Hexokinase_1 10 217 1e-79 PFAM
Pfam:Hexokinase_2 219 458 7.8e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109823
AA Change: R191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105448
Gene: ENSMUSG00000041798
AA Change: R191G

DomainStartEndE-ValueType
Pfam:Hexokinase_1 15 216 1.9e-74 PFAM
Pfam:Hexokinase_2 221 455 2.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125434
SMART Domains Protein: ENSMUSP00000123016
Gene: ENSMUSG00000041798

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
Pfam:Hexokinase_2 45 87 1.1e-8 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. Alternative splicing of this gene results in three tissue-specific forms of glucokinase, one found in pancreatic islet beta cells and two found in liver. The protein localizes to the outer membrane of mitochondria. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. Mutations in this gene have been associated with non-insulin dependent diabetes mellitus (NIDDM), maturity onset diabetes of the young, type 2 (MODY2) and persistent hyperinsulinemic hypoglycemia of infancy (PHHI). [provided by RefSeq, Apr 2009]
PHENOTYPE: Targeted disruption of this gene causes mild hyperglycemia in heterozygous mice and extreme hyperglycemia and embryonic to postnatal lethality in homozygous mice. Hyperglycemic knock-out or ENU-induced mutants may show reduced body weight and liver glycogen level, hepatic steatosis, and glucosuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,584,979 (GRCm39) D865G possibly damaging Het
Acy1 A T 9: 106,313,070 (GRCm39) probably null Het
Adcy4 A T 14: 56,010,104 (GRCm39) probably benign Het
Anpep T G 7: 79,489,047 (GRCm39) D347A probably damaging Het
Arhgap28 C T 17: 68,203,159 (GRCm39) probably null Het
Ccdc32 A G 2: 118,857,610 (GRCm39) probably benign Het
Cdc42bpa A G 1: 179,972,400 (GRCm39) T1401A possibly damaging Het
Celsr2 A G 3: 108,319,939 (GRCm39) Y958H probably damaging Het
Cenpe A G 3: 134,923,066 (GRCm39) E137G probably damaging Het
Chd8 T C 14: 52,450,890 (GRCm39) D1399G probably damaging Het
Cntn3 T C 6: 102,145,908 (GRCm39) T978A possibly damaging Het
Col10a1 A G 10: 34,271,692 (GRCm39) T555A possibly damaging Het
Crybg3 A C 16: 59,385,574 (GRCm39) probably null Het
Cts7 A G 13: 61,503,548 (GRCm39) F139L probably damaging Het
Dera T C 6: 137,773,745 (GRCm39) probably benign Het
Dgka A G 10: 128,559,129 (GRCm39) probably benign Het
Dhrs7 T A 12: 72,699,125 (GRCm39) I286F probably damaging Het
Dtwd2 A G 18: 49,861,424 (GRCm39) probably benign Het
Fermt1 A G 2: 132,748,653 (GRCm39) S657P probably damaging Het
Fhip2b T C 14: 70,825,727 (GRCm39) D351G probably damaging Het
Flnb T C 14: 7,890,810 (GRCm38) V564A probably benign Het
Garnl3 A G 2: 32,975,919 (GRCm39) F16L probably damaging Het
Gucy1b1 A T 3: 81,952,941 (GRCm39) probably benign Het
Ifna2 A C 4: 88,601,895 (GRCm39) L41R probably damaging Het
Krt33a T G 11: 99,903,541 (GRCm39) E197A probably damaging Het
Lce1e G A 3: 92,615,063 (GRCm39) R95C unknown Het
Lct G T 1: 128,235,971 (GRCm39) S345R probably benign Het
Lrp2 A T 2: 69,281,724 (GRCm39) N3882K probably benign Het
Mcc G T 18: 44,578,927 (GRCm39) T652K possibly damaging Het
Mier1 A G 4: 102,996,699 (GRCm39) S109G probably benign Het
Nfat5 A G 8: 108,082,237 (GRCm39) N469S probably damaging Het
Or1e23 C A 11: 73,407,670 (GRCm39) M118I possibly damaging Het
Or6c214 G A 10: 129,591,271 (GRCm39) T16I probably damaging Het
Piwil1 G T 5: 128,820,371 (GRCm39) R256M probably null Het
Rgma T C 7: 73,059,160 (GRCm39) V88A probably damaging Het
Sdk2 T C 11: 113,685,746 (GRCm39) probably null Het
Sec22b A G 3: 97,819,990 (GRCm39) E94G probably damaging Het
Snrnp70 T C 7: 45,036,669 (GRCm39) R131G possibly damaging Het
Spata31d1a A G 13: 59,848,199 (GRCm39) S1310P possibly damaging Het
Spint1 A G 2: 119,076,948 (GRCm39) E344G probably damaging Het
Srrm1 G A 4: 135,052,302 (GRCm39) Q141* probably null Het
Tecta A T 9: 42,295,637 (GRCm39) L286Q probably damaging Het
Tep1 T A 14: 51,104,301 (GRCm39) K198* probably null Het
Tk2 A G 8: 104,957,824 (GRCm39) V174A probably benign Het
Txndc5 T C 13: 38,691,872 (GRCm39) K165E probably damaging Het
Ubr4 G A 4: 139,151,217 (GRCm39) R1884Q probably damaging Het
Vmn2r61 T C 7: 41,949,844 (GRCm39) Y755H probably damaging Het
Xrn1 T A 9: 95,855,592 (GRCm39) H296Q probably damaging Het
Zar1l A T 5: 150,436,407 (GRCm39) V223D probably damaging Het
Other mutations in Gck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Gck APN 11 5,853,106 (GRCm39) missense possibly damaging 0.67
IGL01647:Gck APN 11 5,854,472 (GRCm39) missense probably damaging 0.97
IGL03145:Gck APN 11 5,859,093 (GRCm39) missense probably damaging 0.99
Grahamcracker UTSW 11 5,852,165 (GRCm39) missense probably damaging 1.00
Tootsie UTSW 11 5,859,150 (GRCm39) missense possibly damaging 0.63
R0139:Gck UTSW 11 5,860,370 (GRCm39) missense probably damaging 1.00
R0139:Gck UTSW 11 5,859,139 (GRCm39) nonsense probably null
R1829:Gck UTSW 11 5,860,984 (GRCm39) missense probably damaging 0.97
R1866:Gck UTSW 11 5,853,253 (GRCm39) missense probably benign 0.02
R1868:Gck UTSW 11 5,852,165 (GRCm39) missense probably damaging 1.00
R1992:Gck UTSW 11 5,856,515 (GRCm39) missense probably damaging 1.00
R3885:Gck UTSW 11 5,860,318 (GRCm39) missense probably damaging 1.00
R4179:Gck UTSW 11 5,860,295 (GRCm39) missense probably benign 0.43
R4888:Gck UTSW 11 5,859,150 (GRCm39) missense possibly damaging 0.63
R7034:Gck UTSW 11 5,851,747 (GRCm39) missense probably damaging 1.00
R7155:Gck UTSW 11 5,899,705 (GRCm39) start gained probably benign
R7548:Gck UTSW 11 5,852,040 (GRCm39) missense
R8039:Gck UTSW 11 5,860,301 (GRCm39) missense probably benign 0.12
R8891:Gck UTSW 11 5,851,733 (GRCm39) missense probably damaging 1.00
R9100:Gck UTSW 11 5,856,516 (GRCm39) missense probably damaging 1.00
R9101:Gck UTSW 11 5,856,516 (GRCm39) missense probably damaging 1.00
R9102:Gck UTSW 11 5,856,516 (GRCm39) missense probably damaging 1.00
R9116:Gck UTSW 11 5,854,377 (GRCm39) missense possibly damaging 0.71
R9370:Gck UTSW 11 5,852,244 (GRCm39) missense possibly damaging 0.78
R9420:Gck UTSW 11 5,899,553 (GRCm39) critical splice donor site probably null
R9536:Gck UTSW 11 5,852,307 (GRCm39) missense possibly damaging 0.92
Z1176:Gck UTSW 11 5,856,526 (GRCm39) missense probably damaging 1.00
Z1177:Gck UTSW 11 5,860,958 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CATTGGCGGTCTTCATAGTAGCAGG -3'
(R):5'- ATTGCTCCCAGTGCCTCTCAAAG -3'

Sequencing Primer
(F):5'- GTCTTCATAGTAGCAGGAGATCATTG -3'
(R):5'- AGTGCCTCTCAAAGCTGTG -3'
Posted On 2013-07-30