Incidental Mutation 'R8265:Sppl2b'
ID639690
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R8265 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80866069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A G 19: 3,716,568 T52A probably benign Het
Adam9 T C 8: 24,967,186 Y642C probably damaging Het
Atp2c1 T C 9: 105,470,116 E47G probably benign Het
Btbd9 T A 17: 30,334,304 T395S possibly damaging Het
Cacna1s G A 1: 136,092,626 W800* probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Ceacam20 G A 7: 19,974,234 V255M probably damaging Het
Cit C A 5: 115,988,177 L1610M probably damaging Het
Cped1 A G 6: 22,222,427 T729A probably benign Het
D3Ertd254e T C 3: 36,159,528 probably benign Het
Ddx19b A T 8: 111,009,192 V407E probably damaging Het
Dst A G 1: 34,178,522 K1348E probably benign Het
E2f4 T A 8: 105,301,345 S302T probably damaging Het
Eif1 A G 11: 100,320,473 E31G probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Herc1 C T 9: 66,386,704 Q443* probably null Het
Hmgxb3 A G 18: 61,167,338 V222A possibly damaging Het
Hnrnpu A T 1: 178,332,160 I452N unknown Het
Ints1 C G 5: 139,772,164 D260H probably damaging Het
Kdm5a T A 6: 120,406,596 M766K possibly damaging Het
Lama4 G A 10: 39,105,204 C1720Y probably damaging Het
Mei1 C A 15: 82,103,307 Y433* probably null Het
Milr1 A G 11: 106,763,885 K188E probably benign Het
Myo7a A G 7: 98,085,397 F630S probably benign Het
Myoz2 A G 3: 123,006,523 F219L probably benign Het
Nt5c1a T C 4: 123,214,160 V212A possibly damaging Het
Olfr585 A G 7: 103,098,097 T119A probably benign Het
Olfr620 A T 7: 103,611,841 C171S possibly damaging Het
Olfr901 T C 9: 38,431,173 V297A probably damaging Het
Pi16 A G 17: 29,326,973 T242A probably benign Het
Pigw C A 11: 84,880,021 probably benign Het
Pipox T A 11: 77,883,967 T97S probably benign Het
Plagl1 C A 10: 13,128,881 A631E unknown Het
Poteg T A 8: 27,494,895 H427Q possibly damaging Het
Prdm14 A G 1: 13,114,394 S518P probably damaging Het
Rabep2 A G 7: 126,444,251 E441G probably benign Het
Rasal3 A G 17: 32,395,820 probably null Het
Rbm33 T C 5: 28,394,324 V90A Het
Sidt1 C A 16: 44,267,887 R381M possibly damaging Het
Srsf5 A G 12: 80,947,336 D51G possibly damaging Het
Taar8a T A 10: 24,076,941 S148T probably damaging Het
Tmem59l A G 8: 70,485,776 S149P probably damaging Het
Trafd1 T A 5: 121,373,277 I493F possibly damaging Het
Trrap C T 5: 144,785,534 S289L possibly damaging Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R4350:Sppl2b UTSW 10 80862726 missense probably benign 0.12
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8212:Sppl2b UTSW 10 80865359 missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80866069 frame shift probably null
R8367:Sppl2b UTSW 10 80863191 missense probably benign 0.02
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8398:Sppl2b UTSW 10 80866069 frame shift probably null
R8400:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8481:Sppl2b UTSW 10 80866069 frame shift probably null
R8505:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8818:Sppl2b UTSW 10 80866069 frame shift probably null
R8832:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATGTGCATGCCCATTGTCACC -3'
(R):5'- TGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On2020-07-28