Incidental Mutation 'R8265:Sppl2b'
ID 639690
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Name signal peptide peptidase like 2B
Synonyms 3110056O03Rik
MMRRC Submission 067690-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R8265 (G1)
Quality Score 217.468
Status Not validated
Chromosome 10
Chromosomal Location 80691109-80704542 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80701903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
AlphaFold Q3TD49
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A G 19: 3,766,568 (GRCm39) T52A probably benign Het
Adam9 T C 8: 25,457,202 (GRCm39) Y642C probably damaging Het
Atp2c1 T C 9: 105,347,315 (GRCm39) E47G probably benign Het
Btbd9 T A 17: 30,553,278 (GRCm39) T395S possibly damaging Het
Cacna1s G A 1: 136,020,364 (GRCm39) W800* probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Ceacam20 G A 7: 19,708,159 (GRCm39) V255M probably damaging Het
Cit C A 5: 116,126,236 (GRCm39) L1610M probably damaging Het
Cped1 A G 6: 22,222,426 (GRCm39) T729A probably benign Het
Ddx19b A T 8: 111,735,824 (GRCm39) V407E probably damaging Het
Dst A G 1: 34,217,603 (GRCm39) K1348E probably benign Het
E2f4 T A 8: 106,027,977 (GRCm39) S302T probably damaging Het
Eif1 A G 11: 100,211,299 (GRCm39) E31G probably benign Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Herc1 C T 9: 66,293,986 (GRCm39) Q443* probably null Het
Hmgxb3 A G 18: 61,300,410 (GRCm39) V222A possibly damaging Het
Hnrnpu A T 1: 178,159,725 (GRCm39) I452N unknown Het
Ints1 C G 5: 139,757,919 (GRCm39) D260H probably damaging Het
Kdm5a T A 6: 120,383,557 (GRCm39) M766K possibly damaging Het
Lama4 G A 10: 38,981,200 (GRCm39) C1720Y probably damaging Het
Mei1 C A 15: 81,987,508 (GRCm39) Y433* probably null Het
Milr1 A G 11: 106,654,711 (GRCm39) K188E probably benign Het
Myo7a A G 7: 97,734,604 (GRCm39) F630S probably benign Het
Myoz2 A G 3: 122,800,172 (GRCm39) F219L probably benign Het
Nt5c1a T C 4: 123,107,953 (GRCm39) V212A possibly damaging Het
Or51f1e A G 7: 102,747,304 (GRCm39) T119A probably benign Het
Or51v14 A T 7: 103,261,048 (GRCm39) C171S possibly damaging Het
Or8b42 T C 9: 38,342,469 (GRCm39) V297A probably damaging Het
Pi16 A G 17: 29,545,947 (GRCm39) T242A probably benign Het
Pigw C A 11: 84,770,847 (GRCm39) probably benign Het
Pipox T A 11: 77,774,793 (GRCm39) T97S probably benign Het
Plagl1 C A 10: 13,004,625 (GRCm39) A631E unknown Het
Poteg T A 8: 27,984,923 (GRCm39) H427Q possibly damaging Het
Prdm14 A G 1: 13,184,618 (GRCm39) S518P probably damaging Het
Rabep2 A G 7: 126,043,423 (GRCm39) E441G probably benign Het
Rasal3 A G 17: 32,614,794 (GRCm39) probably null Het
Rbm33 T C 5: 28,599,322 (GRCm39) V90A Het
Sidt1 C A 16: 44,088,250 (GRCm39) R381M possibly damaging Het
Srsf5 A G 12: 80,994,110 (GRCm39) D51G possibly damaging Het
Taar8a T A 10: 23,952,839 (GRCm39) S148T probably damaging Het
Tmem59l A G 8: 70,938,426 (GRCm39) S149P probably damaging Het
Trafd1 T A 5: 121,511,340 (GRCm39) I493F possibly damaging Het
Trrap C T 5: 144,722,344 (GRCm39) S289L possibly damaging Het
Zfp267 T C 3: 36,213,677 (GRCm39) probably benign Het
Zfp955a C T 17: 33,463,087 (GRCm39) V15M probably damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80,699,928 (GRCm39) missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80,701,175 (GRCm39) missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80,697,220 (GRCm39) missense probably benign 0.00
IGL01964:Sppl2b APN 10 80,701,220 (GRCm39) critical splice donor site probably null
IGL02376:Sppl2b APN 10 80,703,432 (GRCm39) nonsense probably null
R1641:Sppl2b UTSW 10 80,700,965 (GRCm39) missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80,701,451 (GRCm39) missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R3106:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R4350:Sppl2b UTSW 10 80,698,560 (GRCm39) missense probably benign 0.12
R5146:Sppl2b UTSW 10 80,703,474 (GRCm39) makesense probably null
R5698:Sppl2b UTSW 10 80,701,879 (GRCm39) splice site probably null
R6969:Sppl2b UTSW 10 80,700,959 (GRCm39) missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80,703,253 (GRCm39) missense probably benign 0.02
R8212:Sppl2b UTSW 10 80,701,193 (GRCm39) missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8367:Sppl2b UTSW 10 80,699,025 (GRCm39) missense probably benign 0.02
R8398:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8398:Sppl2b UTSW 10 80,701,902 (GRCm39) frame shift probably null
R8400:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8480:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8481:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8505:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8817:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8818:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8832:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R9175:Sppl2b UTSW 10 80,698,807 (GRCm39) missense probably benign
R9624:Sppl2b UTSW 10 80,699,373 (GRCm39) missense probably benign 0.03
Z1176:Sppl2b UTSW 10 80,703,259 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATGTGCATGCCCATTGTCACC -3'
(R):5'- TGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On 2020-07-28