Incidental Mutation 'R8265:1810055G02Rik'
ID639703
Institutional Source Beutler Lab
Gene Symbol 1810055G02Rik
Ensembl Gene ENSMUSG00000035372
Gene NameRIKEN cDNA 1810055G02 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8265 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3708333-3717881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3716568 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 52 (T52A)
Ref Sequence ENSEMBL: ENSMUSP00000047063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039048]
Predicted Effect probably benign
Transcript: ENSMUST00000039048
AA Change: T52A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047063
Gene: ENSMUSG00000035372
AA Change: T52A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
low complexity region 265 288 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 T C 8: 24,967,186 Y642C probably damaging Het
Atp2c1 T C 9: 105,470,116 E47G probably benign Het
Btbd9 T A 17: 30,334,304 T395S possibly damaging Het
Cacna1s G A 1: 136,092,626 W800* probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Ceacam20 G A 7: 19,974,234 V255M probably damaging Het
Cit C A 5: 115,988,177 L1610M probably damaging Het
Cped1 A G 6: 22,222,427 T729A probably benign Het
D3Ertd254e T C 3: 36,159,528 probably benign Het
Ddx19b A T 8: 111,009,192 V407E probably damaging Het
Dst A G 1: 34,178,522 K1348E probably benign Het
E2f4 T A 8: 105,301,345 S302T probably damaging Het
Eif1 A G 11: 100,320,473 E31G probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Herc1 C T 9: 66,386,704 Q443* probably null Het
Hmgxb3 A G 18: 61,167,338 V222A possibly damaging Het
Hnrnpu A T 1: 178,332,160 I452N unknown Het
Ints1 C G 5: 139,772,164 D260H probably damaging Het
Kdm5a T A 6: 120,406,596 M766K possibly damaging Het
Lama4 G A 10: 39,105,204 C1720Y probably damaging Het
Mei1 C A 15: 82,103,307 Y433* probably null Het
Milr1 A G 11: 106,763,885 K188E probably benign Het
Myo7a A G 7: 98,085,397 F630S probably benign Het
Myoz2 A G 3: 123,006,523 F219L probably benign Het
Nt5c1a T C 4: 123,214,160 V212A possibly damaging Het
Olfr585 A G 7: 103,098,097 T119A probably benign Het
Olfr620 A T 7: 103,611,841 C171S possibly damaging Het
Olfr901 T C 9: 38,431,173 V297A probably damaging Het
Pi16 A G 17: 29,326,973 T242A probably benign Het
Pigw C A 11: 84,880,021 probably benign Het
Pipox T A 11: 77,883,967 T97S probably benign Het
Plagl1 C A 10: 13,128,881 A631E unknown Het
Poteg T A 8: 27,494,895 H427Q possibly damaging Het
Prdm14 A G 1: 13,114,394 S518P probably damaging Het
Rabep2 A G 7: 126,444,251 E441G probably benign Het
Rasal3 A G 17: 32,395,820 probably null Het
Rbm33 T C 5: 28,394,324 V90A Het
Sidt1 C A 16: 44,267,887 R381M possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srsf5 A G 12: 80,947,336 D51G possibly damaging Het
Taar8a T A 10: 24,076,941 S148T probably damaging Het
Tmem59l A G 8: 70,485,776 S149P probably damaging Het
Trafd1 T A 5: 121,373,277 I493F possibly damaging Het
Trrap C T 5: 144,785,534 S289L possibly damaging Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Other mutations in 1810055G02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:1810055G02Rik APN 19 3717040 missense probably benign 0.02
IGL02883:1810055G02Rik APN 19 3716972 missense possibly damaging 0.83
R0909:1810055G02Rik UTSW 19 3715788 missense probably benign 0.00
R1482:1810055G02Rik UTSW 19 3717192 missense probably benign 0.01
R2158:1810055G02Rik UTSW 19 3716608 missense possibly damaging 0.46
R4833:1810055G02Rik UTSW 19 3716872 missense possibly damaging 0.87
R5012:1810055G02Rik UTSW 19 3717217 missense possibly damaging 0.92
R5557:1810055G02Rik UTSW 19 3717501 missense possibly damaging 0.66
R7411:1810055G02Rik UTSW 19 3717241 missense possibly damaging 0.92
R7573:1810055G02Rik UTSW 19 3715728 start codon destroyed probably null 0.04
R8164:1810055G02Rik UTSW 19 3717454 missense probably benign
X0026:1810055G02Rik UTSW 19 3716826 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATGTGTCACCTCCATCAGCAC -3'
(R):5'- TGTAGGTACAGCCAGAGTTCTG -3'

Sequencing Primer
(F):5'- GAATATGGTGTTGTACAGCTAGCAC -3'
(R):5'- AGAGTTCTGGAGGTCACCCTG -3'
Posted On2020-07-28