Incidental Mutation 'R8265:1810055G02Rik'
ID 639703
Institutional Source Beutler Lab
Gene Symbol 1810055G02Rik
Ensembl Gene ENSMUSG00000035372
Gene Name RIKEN cDNA 1810055G02 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8265 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 3708333-3717881 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3716568 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 52 (T52A)
Ref Sequence ENSEMBL: ENSMUSP00000047063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039048]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039048
AA Change: T52A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047063
Gene: ENSMUSG00000035372
AA Change: T52A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
low complexity region 265 288 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 T C 8: 24,967,186 Y642C probably damaging Het
Atp2c1 T C 9: 105,470,116 E47G probably benign Het
Btbd9 T A 17: 30,334,304 T395S possibly damaging Het
Cacna1s G A 1: 136,092,626 W800* probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Ceacam20 G A 7: 19,974,234 V255M probably damaging Het
Cit C A 5: 115,988,177 L1610M probably damaging Het
Cped1 A G 6: 22,222,427 T729A probably benign Het
D3Ertd254e T C 3: 36,159,528 probably benign Het
Ddx19b A T 8: 111,009,192 V407E probably damaging Het
Dst A G 1: 34,178,522 K1348E probably benign Het
E2f4 T A 8: 105,301,345 S302T probably damaging Het
Eif1 A G 11: 100,320,473 E31G probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Herc1 C T 9: 66,386,704 Q443* probably null Het
Hmgxb3 A G 18: 61,167,338 V222A possibly damaging Het
Hnrnpu A T 1: 178,332,160 I452N unknown Het
Ints1 C G 5: 139,772,164 D260H probably damaging Het
Kdm5a T A 6: 120,406,596 M766K possibly damaging Het
Lama4 G A 10: 39,105,204 C1720Y probably damaging Het
Mei1 C A 15: 82,103,307 Y433* probably null Het
Milr1 A G 11: 106,763,885 K188E probably benign Het
Myo7a A G 7: 98,085,397 F630S probably benign Het
Myoz2 A G 3: 123,006,523 F219L probably benign Het
Nt5c1a T C 4: 123,214,160 V212A possibly damaging Het
Olfr585 A G 7: 103,098,097 T119A probably benign Het
Olfr620 A T 7: 103,611,841 C171S possibly damaging Het
Olfr901 T C 9: 38,431,173 V297A probably damaging Het
Pi16 A G 17: 29,326,973 T242A probably benign Het
Pigw C A 11: 84,880,021 probably benign Het
Pipox T A 11: 77,883,967 T97S probably benign Het
Plagl1 C A 10: 13,128,881 A631E unknown Het
Poteg T A 8: 27,494,895 H427Q possibly damaging Het
Prdm14 A G 1: 13,114,394 S518P probably damaging Het
Rabep2 A G 7: 126,444,251 E441G probably benign Het
Rasal3 A G 17: 32,395,820 probably null Het
Rbm33 T C 5: 28,394,324 V90A Het
Sidt1 C A 16: 44,267,887 R381M possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srsf5 A G 12: 80,947,336 D51G possibly damaging Het
Taar8a T A 10: 24,076,941 S148T probably damaging Het
Tmem59l A G 8: 70,485,776 S149P probably damaging Het
Trafd1 T A 5: 121,373,277 I493F possibly damaging Het
Trrap C T 5: 144,785,534 S289L possibly damaging Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Other mutations in 1810055G02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:1810055G02Rik APN 19 3717040 missense probably benign 0.02
IGL02883:1810055G02Rik APN 19 3716972 missense possibly damaging 0.83
R0909:1810055G02Rik UTSW 19 3715788 missense probably benign 0.00
R1482:1810055G02Rik UTSW 19 3717192 missense probably benign 0.01
R2158:1810055G02Rik UTSW 19 3716608 missense possibly damaging 0.46
R4833:1810055G02Rik UTSW 19 3716872 missense possibly damaging 0.87
R5012:1810055G02Rik UTSW 19 3717217 missense possibly damaging 0.92
R5557:1810055G02Rik UTSW 19 3717501 missense possibly damaging 0.66
R7411:1810055G02Rik UTSW 19 3717241 missense possibly damaging 0.92
R7573:1810055G02Rik UTSW 19 3715728 start codon destroyed probably null 0.04
R8164:1810055G02Rik UTSW 19 3717454 missense probably benign
R8781:1810055G02Rik UTSW 19 3717538 missense possibly damaging 0.90
R8906:1810055G02Rik UTSW 19 3716686 missense possibly damaging 0.82
R9224:1810055G02Rik UTSW 19 3717100 missense possibly damaging 0.66
X0026:1810055G02Rik UTSW 19 3716826 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATGTGTCACCTCCATCAGCAC -3'
(R):5'- TGTAGGTACAGCCAGAGTTCTG -3'

Sequencing Primer
(F):5'- GAATATGGTGTTGTACAGCTAGCAC -3'
(R):5'- AGAGTTCTGGAGGTCACCCTG -3'
Posted On 2020-07-28