Incidental Mutation 'R8264:Sema4c'
ID 639706
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Name sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
Synonyms M-Sema F, Semacl1, Semaf, Semai, Semacl1
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 36587720-36597430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 36591966 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 266 (G266R)
Ref Sequence ENSEMBL: ENSMUSP00000110643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000195339] [ENSMUST00000195620]
AlphaFold Q64151
Predicted Effect probably damaging
Transcript: ENSMUST00000114991
AA Change: G266R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: G266R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191642
AA Change: G266R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: G266R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191677
AA Change: G266R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: G266R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Predicted Effect probably benign
Transcript: ENSMUST00000195339
Predicted Effect probably damaging
Transcript: ENSMUST00000195620
AA Change: G266R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: G266R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36,593,001 (GRCm39) critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36,592,110 (GRCm39) missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36,592,166 (GRCm39) missense probably damaging 1.00
IGL02262:Sema4c APN 1 36,589,422 (GRCm39) missense probably damaging 1.00
IGL02282:Sema4c APN 1 36,589,284 (GRCm39) splice site probably null
IGL02476:Sema4c APN 1 36,595,031 (GRCm39) missense probably damaging 0.98
IGL02900:Sema4c APN 1 36,589,826 (GRCm39) nonsense probably null
swirl UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36,591,965 (GRCm39) missense probably damaging 1.00
R0427:Sema4c UTSW 1 36,592,892 (GRCm39) nonsense probably null
R0497:Sema4c UTSW 1 36,588,689 (GRCm39) missense probably benign 0.04
R1066:Sema4c UTSW 1 36,589,281 (GRCm39) missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36,591,191 (GRCm39) missense probably damaging 1.00
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1639:Sema4c UTSW 1 36,592,615 (GRCm39) missense probably benign 0.00
R1644:Sema4c UTSW 1 36,589,885 (GRCm39) missense probably damaging 1.00
R3176:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3276:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3277:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3551:Sema4c UTSW 1 36,592,804 (GRCm39) missense probably benign 0.02
R4452:Sema4c UTSW 1 36,592,837 (GRCm39) missense probably benign 0.31
R4883:Sema4c UTSW 1 36,591,097 (GRCm39) missense probably damaging 0.98
R4895:Sema4c UTSW 1 36,592,651 (GRCm39) splice site probably null
R4913:Sema4c UTSW 1 36,589,266 (GRCm39) missense probably benign 0.11
R4944:Sema4c UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
R5062:Sema4c UTSW 1 36,592,059 (GRCm39) critical splice donor site probably null
R5077:Sema4c UTSW 1 36,590,812 (GRCm39) missense probably benign 0.20
R5109:Sema4c UTSW 1 36,591,381 (GRCm39) frame shift probably null
R5208:Sema4c UTSW 1 36,589,407 (GRCm39) missense probably damaging 1.00
R5551:Sema4c UTSW 1 36,591,398 (GRCm39) missense probably damaging 1.00
R5912:Sema4c UTSW 1 36,593,469 (GRCm39) missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36,589,834 (GRCm39) missense probably benign 0.02
R7111:Sema4c UTSW 1 36,592,160 (GRCm39) missense possibly damaging 0.48
R7141:Sema4c UTSW 1 36,592,101 (GRCm39) missense probably damaging 0.99
R7252:Sema4c UTSW 1 36,589,096 (GRCm39) missense probably damaging 1.00
R7495:Sema4c UTSW 1 36,589,774 (GRCm39) missense probably benign 0.00
R7891:Sema4c UTSW 1 36,588,995 (GRCm39) missense probably damaging 0.98
R7895:Sema4c UTSW 1 36,592,199 (GRCm39) missense probably damaging 1.00
R8478:Sema4c UTSW 1 36,590,871 (GRCm39) missense probably benign 0.04
R8680:Sema4c UTSW 1 36,589,867 (GRCm39) missense probably benign 0.00
R8733:Sema4c UTSW 1 36,591,954 (GRCm39) missense probably damaging 1.00
R9017:Sema4c UTSW 1 36,592,079 (GRCm39) missense probably damaging 1.00
R9344:Sema4c UTSW 1 36,592,395 (GRCm39) missense probably damaging 1.00
R9488:Sema4c UTSW 1 36,591,067 (GRCm39) missense probably benign
X0019:Sema4c UTSW 1 36,592,077 (GRCm39) missense probably damaging 1.00
X0028:Sema4c UTSW 1 36,589,047 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGTCATCTTGGCTGCCAGG -3'
(R):5'- TTCTTCTTCAGTGAGCGGGC -3'

Sequencing Primer
(F):5'- ACTGACCCGCTGGACTTC -3'
(R):5'- CAGTGGAGTATGACTGCTATTCC -3'
Posted On 2020-07-28