Incidental Mutation 'R8264:Aox1'
ID 639707
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Name aldehyde oxidase 1
Synonyms Aox-1, retinal oxidase, Aox-2, Aox2
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8264 (G1)
Quality Score 197.009
Status Validated
Chromosome 1
Chromosomal Location 58069090-58145572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58092873 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 162 (T162A)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000001027
AA Change: T162A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: T162A

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58,098,203 (GRCm39) missense probably damaging 1.00
IGL01014:Aox1 APN 1 58,361,960 (GRCm39) missense possibly damaging 0.73
IGL01077:Aox1 APN 1 58,096,569 (GRCm39) splice site probably benign
IGL01288:Aox1 APN 1 58,333,566 (GRCm39) missense probably damaging 0.99
IGL01335:Aox1 APN 1 58,121,312 (GRCm39) nonsense probably null
IGL01383:Aox1 APN 1 58,333,464 (GRCm39) missense probably benign 0.09
IGL01410:Aox1 APN 1 58,145,184 (GRCm39) splice site probably null
IGL01684:Aox1 APN 1 58,116,740 (GRCm39) splice site probably null
IGL01727:Aox1 APN 1 58,112,387 (GRCm39) nonsense probably null
IGL01734:Aox1 APN 1 58,393,469 (GRCm39) missense possibly damaging 0.95
IGL01793:Aox1 APN 1 58,375,783 (GRCm39) missense possibly damaging 0.79
IGL01805:Aox1 APN 1 58,120,672 (GRCm39) missense possibly damaging 0.94
IGL01834:Aox1 APN 1 58,348,183 (GRCm39) missense possibly damaging 0.90
IGL01924:Aox1 APN 1 58,326,902 (GRCm39) missense possibly damaging 0.90
IGL01996:Aox1 APN 1 58,121,225 (GRCm39) missense probably benign 0.11
IGL02060:Aox1 APN 1 58,137,114 (GRCm39) missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58,104,499 (GRCm39) missense probably benign 0.00
IGL02591:Aox1 APN 1 58,398,158 (GRCm39) nonsense probably null
IGL02645:Aox1 APN 1 58,373,883 (GRCm39) missense probably damaging 1.00
IGL02710:Aox1 APN 1 58,373,928 (GRCm39) critical splice donor site probably null
IGL02801:Aox1 APN 1 58,393,336 (GRCm39) missense probably damaging 1.00
IGL02839:Aox1 APN 1 58,107,943 (GRCm39) missense probably benign 0.05
IGL02975:Aox1 APN 1 58,107,550 (GRCm39) missense probably damaging 1.00
IGL02988:Aox1 APN 1 58,376,509 (GRCm39) missense probably benign
IGL03062:Aox1 APN 1 58,117,624 (GRCm39) missense probably benign 0.01
IGL03104:Aox1 APN 1 58,321,918 (GRCm39) missense probably benign
IGL03121:Aox1 APN 1 58,398,113 (GRCm39) missense probably damaging 1.00
IGL03191:Aox1 APN 1 58,398,228 (GRCm39) missense probably null 0.98
IGL03236:Aox1 APN 1 58,349,156 (GRCm39) nonsense probably null
IGL03286:Aox1 APN 1 58,088,543 (GRCm39) missense probably benign 0.19
IGL03335:Aox1 APN 1 58,115,319 (GRCm39) missense probably damaging 0.98
IGL03395:Aox1 APN 1 58,107,884 (GRCm39) splice site probably benign
IGL03409:Aox1 APN 1 58,393,588 (GRCm39) missense possibly damaging 0.91
PIT4362001:Aox1 UTSW 1 58,321,839 (GRCm39) missense probably damaging 1.00
R0035:Aox1 UTSW 1 58,393,581 (GRCm39) missense probably benign 0.00
R0035:Aox1 UTSW 1 58,393,581 (GRCm39) missense probably benign 0.00
R0048:Aox1 UTSW 1 58,112,371 (GRCm39) missense probably damaging 0.98
R0144:Aox1 UTSW 1 58,109,233 (GRCm39) missense probably benign 0.00
R0207:Aox1 UTSW 1 58,144,173 (GRCm39) missense possibly damaging 0.82
R0267:Aox1 UTSW 1 58,378,605 (GRCm39) splice site probably benign
R0357:Aox1 UTSW 1 58,131,675 (GRCm39) missense probably damaging 1.00
R0383:Aox1 UTSW 1 58,100,400 (GRCm39) missense probably benign 0.00
R0388:Aox1 UTSW 1 58,393,565 (GRCm39) missense probably damaging 1.00
R0399:Aox1 UTSW 1 58,108,008 (GRCm39) splice site probably null
R0409:Aox1 UTSW 1 58,375,783 (GRCm39) missense possibly damaging 0.90
R0465:Aox1 UTSW 1 58,101,366 (GRCm39) missense probably damaging 1.00
R0480:Aox1 UTSW 1 58,082,810 (GRCm39) splice site probably benign
R0547:Aox1 UTSW 1 58,349,201 (GRCm39) missense probably damaging 0.96
R0630:Aox1 UTSW 1 58,376,480 (GRCm39) splice site probably benign
R0726:Aox1 UTSW 1 58,373,941 (GRCm39) splice site probably benign
R0734:Aox1 UTSW 1 58,344,500 (GRCm39) missense probably benign 0.22
R0831:Aox1 UTSW 1 58,378,842 (GRCm39) missense probably benign 0.28
R0961:Aox1 UTSW 1 58,349,230 (GRCm39) missense probably benign 0.00
R1005:Aox1 UTSW 1 58,104,511 (GRCm39) missense probably benign 0.00
R1404:Aox1 UTSW 1 58,385,371 (GRCm39) splice site probably benign
R1507:Aox1 UTSW 1 58,143,610 (GRCm39) missense probably benign 0.01
R1512:Aox1 UTSW 1 58,346,510 (GRCm39) missense probably benign 0.00
R1573:Aox1 UTSW 1 58,348,186 (GRCm39) missense probably benign 0.00
R1592:Aox1 UTSW 1 58,339,853 (GRCm39) missense probably benign 0.00
R1597:Aox1 UTSW 1 58,086,326 (GRCm39) missense probably damaging 1.00
R1693:Aox1 UTSW 1 58,124,701 (GRCm39) missense probably damaging 1.00
R1709:Aox1 UTSW 1 58,116,633 (GRCm39) missense probably benign
R1747:Aox1 UTSW 1 58,378,751 (GRCm39) missense probably benign 0.01
R1768:Aox1 UTSW 1 58,393,354 (GRCm39) missense probably benign 0.00
R1809:Aox1 UTSW 1 58,333,484 (GRCm39) missense probably benign
R1823:Aox1 UTSW 1 58,351,518 (GRCm39) missense probably benign 0.02
R1834:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1835:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1836:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1869:Aox1 UTSW 1 58,115,262 (GRCm39) missense probably damaging 1.00
R1870:Aox1 UTSW 1 58,115,262 (GRCm39) missense probably damaging 1.00
R1898:Aox1 UTSW 1 58,117,601 (GRCm39) missense probably damaging 1.00
R1908:Aox1 UTSW 1 58,141,783 (GRCm39) missense probably damaging 1.00
R2002:Aox1 UTSW 1 58,086,300 (GRCm39) missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58,098,351 (GRCm39) splice site probably null
R2065:Aox1 UTSW 1 58,098,351 (GRCm39) splice site probably null
R2219:Aox1 UTSW 1 58,388,289 (GRCm39) splice site probably null
R2220:Aox1 UTSW 1 58,388,289 (GRCm39) splice site probably null
R2265:Aox1 UTSW 1 58,120,679 (GRCm39) missense probably damaging 0.99
R2508:Aox1 UTSW 1 58,382,832 (GRCm39) missense probably benign 0.38
R2942:Aox1 UTSW 1 58,376,540 (GRCm39) missense probably benign 0.03
R2967:Aox1 UTSW 1 58,361,993 (GRCm39) missense probably damaging 0.96
R3082:Aox1 UTSW 1 58,322,759 (GRCm39) splice site probably benign
R3161:Aox1 UTSW 1 58,343,597 (GRCm39) missense possibly damaging 0.91
R3408:Aox1 UTSW 1 58,382,827 (GRCm39) missense probably benign 0.32
R3713:Aox1 UTSW 1 58,095,374 (GRCm39) missense probably benign 0.01
R3778:Aox1 UTSW 1 58,092,862 (GRCm39) missense possibly damaging 0.89
R3803:Aox1 UTSW 1 58,329,058 (GRCm39) splice site probably null
R3894:Aox1 UTSW 1 58,373,837 (GRCm39) critical splice acceptor site probably null
R4198:Aox1 UTSW 1 58,124,766 (GRCm39) missense probably benign
R4214:Aox1 UTSW 1 58,346,603 (GRCm39) critical splice donor site probably null
R4249:Aox1 UTSW 1 58,338,978 (GRCm39) missense probably benign 0.01
R4296:Aox1 UTSW 1 58,096,559 (GRCm39) splice site probably null
R4562:Aox1 UTSW 1 58,098,215 (GRCm39) missense probably damaging 0.99
R4666:Aox1 UTSW 1 58,343,756 (GRCm39) nonsense probably null
R4668:Aox1 UTSW 1 58,373,853 (GRCm39) missense possibly damaging 0.63
R4703:Aox1 UTSW 1 58,398,116 (GRCm39) missense possibly damaging 0.78
R4758:Aox1 UTSW 1 58,371,741 (GRCm39) missense probably benign 0.00
R4858:Aox1 UTSW 1 58,143,640 (GRCm39) missense probably benign
R4862:Aox1 UTSW 1 58,134,316 (GRCm39) missense probably damaging 0.98
R4890:Aox1 UTSW 1 58,373,862 (GRCm39) missense probably benign 0.11
R4900:Aox1 UTSW 1 58,344,544 (GRCm39) missense probably benign
R4924:Aox1 UTSW 1 58,344,503 (GRCm39) missense probably damaging 1.00
R4970:Aox1 UTSW 1 58,349,254 (GRCm39) splice site probably null
R5048:Aox1 UTSW 1 58,098,641 (GRCm39) splice site probably benign
R5112:Aox1 UTSW 1 58,349,254 (GRCm39) splice site probably null
R5127:Aox1 UTSW 1 58,069,185 (GRCm39) missense probably benign 0.00
R5139:Aox1 UTSW 1 58,100,456 (GRCm39) missense probably benign 0.03
R5157:Aox1 UTSW 1 58,109,222 (GRCm39) missense probably damaging 1.00
R5168:Aox1 UTSW 1 58,088,561 (GRCm39) missense probably damaging 1.00
R5186:Aox1 UTSW 1 58,107,529 (GRCm39) missense probably damaging 1.00
R5235:Aox1 UTSW 1 58,096,714 (GRCm39) missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58,131,717 (GRCm39) missense probably damaging 0.99
R5466:Aox1 UTSW 1 58,080,619 (GRCm39) missense probably damaging 1.00
R5540:Aox1 UTSW 1 58,143,569 (GRCm39) missense probably benign 0.03
R5615:Aox1 UTSW 1 58,136,125 (GRCm39) missense probably benign
R5652:Aox1 UTSW 1 58,134,356 (GRCm39) missense probably damaging 1.00
R5920:Aox1 UTSW 1 58,088,631 (GRCm39) missense probably damaging 1.00
R5987:Aox1 UTSW 1 58,346,518 (GRCm39) missense probably benign 0.00
R6008:Aox1 UTSW 1 58,116,672 (GRCm39) missense probably damaging 1.00
R6073:Aox1 UTSW 1 58,143,668 (GRCm39) critical splice donor site probably null
R6215:Aox1 UTSW 1 58,124,620 (GRCm39) missense probably benign
R6239:Aox1 UTSW 1 58,344,550 (GRCm39) critical splice donor site probably null
R6273:Aox1 UTSW 1 58,378,831 (GRCm39) missense probably benign 0.00
R6291:Aox1 UTSW 1 58,369,965 (GRCm39) missense probably damaging 0.98
R6334:Aox1 UTSW 1 58,346,566 (GRCm39) nonsense probably null
R6403:Aox1 UTSW 1 58,107,594 (GRCm39) missense probably damaging 1.00
R6440:Aox1 UTSW 1 58,133,631 (GRCm39) missense probably damaging 1.00
R6601:Aox1 UTSW 1 58,102,665 (GRCm39) missense probably damaging 1.00
R6608:Aox1 UTSW 1 58,096,705 (GRCm39) missense probably benign 0.40
R6752:Aox1 UTSW 1 58,086,398 (GRCm39) missense probably benign 0.00
R6764:Aox1 UTSW 1 58,389,441 (GRCm39) missense probably damaging 0.97
R6766:Aox1 UTSW 1 58,388,227 (GRCm39) missense possibly damaging 0.95
R6789:Aox1 UTSW 1 58,343,644 (GRCm39) missense probably benign 0.01
R6804:Aox1 UTSW 1 58,343,757 (GRCm39) missense probably benign 0.04
R6989:Aox1 UTSW 1 58,124,611 (GRCm39) missense probably damaging 1.00
R7007:Aox1 UTSW 1 58,370,051 (GRCm39) missense probably damaging 1.00
R7015:Aox1 UTSW 1 58,321,917 (GRCm39) missense probably benign 0.00
R7042:Aox1 UTSW 1 58,141,759 (GRCm39) missense probably damaging 0.99
R7055:Aox1 UTSW 1 58,338,927 (GRCm39) missense probably benign 0.08
R7089:Aox1 UTSW 1 58,375,808 (GRCm39) missense probably benign 0.01
R7157:Aox1 UTSW 1 58,322,651 (GRCm39) missense probably benign 0.00
R7303:Aox1 UTSW 1 58,373,924 (GRCm39) nonsense probably null
R7426:Aox1 UTSW 1 58,329,142 (GRCm39) nonsense probably null
R7442:Aox1 UTSW 1 58,121,172 (GRCm39) missense probably damaging 1.00
R7506:Aox1 UTSW 1 58,088,562 (GRCm39) missense probably damaging 1.00
R7563:Aox1 UTSW 1 58,086,304 (GRCm39) missense probably benign 0.32
R7589:Aox1 UTSW 1 58,080,643 (GRCm39) missense probably damaging 1.00
R7735:Aox1 UTSW 1 58,107,451 (GRCm39) missense probably benign 0.01
R7762:Aox1 UTSW 1 58,388,263 (GRCm39) missense probably damaging 1.00
R7814:Aox1 UTSW 1 58,124,626 (GRCm39) missense probably benign
R7876:Aox1 UTSW 1 58,101,330 (GRCm39) nonsense probably null
R7899:Aox1 UTSW 1 58,320,396 (GRCm39) splice site probably null
R7905:Aox1 UTSW 1 58,143,557 (GRCm39) missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58,145,227 (GRCm39) missense possibly damaging 0.68
R7942:Aox1 UTSW 1 58,376,590 (GRCm39) missense probably damaging 1.00
R7975:Aox1 UTSW 1 58,348,187 (GRCm39) missense probably benign 0.02
R8029:Aox1 UTSW 1 58,382,827 (GRCm39) missense probably benign 0.32
R8032:Aox1 UTSW 1 58,389,442 (GRCm39) missense probably benign 0.01
R8116:Aox1 UTSW 1 58,115,283 (GRCm39) missense probably damaging 1.00
R8147:Aox1 UTSW 1 58,339,821 (GRCm39) missense probably benign 0.02
R8165:Aox1 UTSW 1 58,348,088 (GRCm39) missense probably benign 0.08
R8179:Aox1 UTSW 1 58,137,117 (GRCm39) missense probably damaging 1.00
R8284:Aox1 UTSW 1 58,115,250 (GRCm39) missense probably damaging 1.00
R8326:Aox1 UTSW 1 58,335,046 (GRCm39) missense probably benign
R8415:Aox1 UTSW 1 58,080,638 (GRCm39) missense probably damaging 1.00
R8770:Aox1 UTSW 1 58,378,763 (GRCm39) missense probably benign 0.10
R8946:Aox1 UTSW 1 58,145,227 (GRCm39) missense possibly damaging 0.68
R8973:Aox1 UTSW 1 58,329,113 (GRCm39) missense probably benign 0.34
R8988:Aox1 UTSW 1 58,088,625 (GRCm39) missense possibly damaging 0.48
R9015:Aox1 UTSW 1 58,382,851 (GRCm39) missense probably damaging 1.00
R9097:Aox1 UTSW 1 58,326,887 (GRCm39) missense possibly damaging 0.82
R9101:Aox1 UTSW 1 58,371,796 (GRCm39) missense probably benign 0.03
R9108:Aox1 UTSW 1 58,321,851 (GRCm39) missense probably damaging 1.00
R9180:Aox1 UTSW 1 58,378,777 (GRCm39) nonsense probably null
R9258:Aox1 UTSW 1 58,351,515 (GRCm39) missense probably damaging 1.00
R9293:Aox1 UTSW 1 58,361,953 (GRCm39) missense possibly damaging 0.86
R9296:Aox1 UTSW 1 58,124,612 (GRCm39) missense probably damaging 1.00
R9382:Aox1 UTSW 1 58,104,501 (GRCm39) missense possibly damaging 0.48
R9461:Aox1 UTSW 1 58,116,736 (GRCm39) critical splice donor site probably null
R9519:Aox1 UTSW 1 58,373,926 (GRCm39) missense probably damaging 0.98
R9581:Aox1 UTSW 1 58,370,055 (GRCm39) critical splice donor site probably null
Z1088:Aox1 UTSW 1 58,120,701 (GRCm39) missense probably benign 0.01
Z1177:Aox1 UTSW 1 58,393,556 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTGGCCATCTGTCACAAGAC -3'
(R):5'- AGATGCTCACAGCTTGATGC -3'

Sequencing Primer
(F):5'- TCAGGACTCTTGACTTAAATATCCC -3'
(R):5'- CTCCAGGCAGTGAGGTGATG -3'
Posted On 2020-07-28