Mutagenetix > Incidental Mutation

Incidental Mutation 'R8264:Aox1'

639707

Institutional Source

Beutler Lab

Gene Symbol

Aox1

Ensembl Gene

ENSMUSG00000063558

Gene Name

aldehyde oxidase 1

Synonyms

Aox-1, Aox2, retinal oxidase, Aox-2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8264 (G1)

Quality Score

197.009

Status

Validated

Chromosome

Chromosomal Location

58029931-58106413 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58053714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 162 (T162A)

Ref Sequence

ENSEMBL: ENSMUSP00000001027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001027]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001027
AA Change: T162A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: T162A

Domain	Start	End	E-Value	Type
Pfam:Fer2	8	78	8.5e-11	PFAM
Pfam:Fer2_2	87	161	2.4e-32	PFAM
low complexity region	197	209	N/A	INTRINSIC
Pfam:FAD_binding_5	238	418	1.2e-46	PFAM
CO_deh_flav_C	425	529	8.06e-24	SMART
Ald_Xan_dh_C	593	696	6.99e-42	SMART
Pfam:Ald_Xan_dh_C2	707	1240	2.1e-176	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,782	C911S	probably damaging	Het
Abcc4	T	A	14: 118,594,842	N792I	possibly damaging	Het
Acacb	A	T	5: 114,207,366	H960L	probably benign	Het
Cacna1g	T	C	11: 94,473,566	S18G	probably benign	Het
Chfr	T	A	5: 110,152,434	I348N	possibly damaging	Het
Cntln	G	A	4: 85,098,411	R12Q	probably damaging	Het
Cyp2c40	A	G	19: 39,807,527	S136P	possibly damaging	Het
Dnah14	T	A	1: 181,744,792	M2896K	probably damaging	Het
Elp6	A	G	9: 110,319,687	T215A	probably damaging	Het
Esyt2	A	C	12: 116,365,920	Q699H	probably benign	Het
Fbxo25	A	G	8: 13,929,393	T204A	possibly damaging	Het
Fhdc1	A	G	3: 84,455,032	S294P	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Galnt10	A	G	11: 57,782,206	I463V	probably benign	Het
Glce	A	G	9: 62,060,430	F480L	probably benign	Het
H2-Aa	A	G	17: 34,287,735	V11A	probably benign	Het
Hsd17b4	A	G	18: 50,146,526	T191A	possibly damaging	Het
Itpr3	G	T	17: 27,104,112		silent	Het
Izumo4	G	T	10: 80,702,738	G8V		Het
Klk1b5	T	A	7: 44,220,030	L178H	probably damaging	Het
Lama2	T	C	10: 27,467,222	N85D	probably benign	Het
Liph	A	C	16: 21,983,971	I116R	possibly damaging	Het
Lpar5	T	A	6: 125,081,502	V62D	probably damaging	Het
Map3k19	T	A	1: 127,823,791	I303F		Het
Mymk	A	G	2: 27,067,856		probably benign	Het
Myo10	G	A	15: 25,800,109	V1424M	probably damaging	Het
Myof	T	G	19: 37,921,433	Q1528P	probably damaging	Het
Ncapd3	T	C	9: 27,094,742		probably benign	Het
Nup214	T	A	2: 31,994,726	Y500N	possibly damaging	Het
Olfr1040	T	C	2: 86,146,194	D180G	probably damaging	Het
Papd4	C	T	13: 93,175,569	G208S	probably damaging	Het
Pappa2	T	C	1: 158,854,973	Y835C	probably damaging	Het
Pcdh18	T	C	3: 49,756,581	E95G	probably damaging	Het
Phf3	A	T	1: 30,831,057	N303K	possibly damaging	Het
Pnn	C	T	12: 59,072,577	H649Y	unknown	Het
Rab11fip1	G	A	8: 27,152,480	Q764*	probably null	Het
Ralgapa2	A	T	2: 146,333,450	M1762K	possibly damaging	Het
Rif1	G	A	2: 52,090,278	A496T	noncoding transcript	Het
Rnase13	A	T	14: 51,922,457	V75D	probably damaging	Het
Sema3c	G	A	5: 17,676,539		probably benign	Het
Sema4c	C	G	1: 36,552,885	G266R	probably damaging	Het
Slfn5	A	T	11: 82,956,550	D87V	probably damaging	Het
Smpd3	T	C	8: 106,264,658	Y421C	probably damaging	Het
Snrnp40	T	C	4: 130,378,074	V188A	probably benign	Het
Srms	A	G	2: 181,212,550	Y75H	probably benign	Het
Tex15	T	C	8: 33,582,362	S2646P	probably benign	Het
Togaram1	A	G	12: 64,995,556	I1130V	probably benign	Het
Ttf1	A	G	2: 29,064,677	K18E	possibly damaging	Het
Unc5b	G	T	10: 60,768,334	T827K	probably benign	Het
Zfhx2	T	A	14: 55,065,512	T1672S	possibly damaging	Het

Other mutations in Aox1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Aox1	APN	1	58059044	missense	probably damaging	1.00
IGL01077:Aox1	APN	1	58057410	splice site	probably benign
IGL01335:Aox1	APN	1	58082153	nonsense	probably null
IGL01410:Aox1	APN	1	58106025	splice site	probably null
IGL01684:Aox1	APN	1	58077581	splice site	probably null
IGL01727:Aox1	APN	1	58073228	nonsense	probably null
IGL01805:Aox1	APN	1	58081513	missense	possibly damaging	0.94
IGL01996:Aox1	APN	1	58082066	missense	probably benign	0.11
IGL02060:Aox1	APN	1	58097955	missense	possibly damaging	0.95
IGL02206:Aox1	APN	1	58065340	missense	probably benign	0.00
IGL02839:Aox1	APN	1	58068784	missense	probably benign	0.05
IGL02975:Aox1	APN	1	58068391	missense	probably damaging	1.00
IGL03062:Aox1	APN	1	58078465	missense	probably benign	0.01
IGL03286:Aox1	APN	1	58049384	missense	probably benign	0.19
IGL03335:Aox1	APN	1	58076160	missense	probably damaging	0.98
IGL03395:Aox1	APN	1	58068725	splice site	probably benign
R0048:Aox1	UTSW	1	58073212	missense	probably damaging	0.98
R0144:Aox1	UTSW	1	58070074	missense	probably benign	0.00
R0207:Aox1	UTSW	1	58105014	missense	possibly damaging	0.82
R0357:Aox1	UTSW	1	58092516	missense	probably damaging	1.00
R0383:Aox1	UTSW	1	58061241	missense	probably benign	0.00
R0399:Aox1	UTSW	1	58068849	splice site	probably null
R0465:Aox1	UTSW	1	58062207	missense	probably damaging	1.00
R0480:Aox1	UTSW	1	58043651	splice site	probably benign
R1005:Aox1	UTSW	1	58065352	missense	probably benign	0.00
R1507:Aox1	UTSW	1	58104451	missense	probably benign	0.01
R1597:Aox1	UTSW	1	58047167	missense	probably damaging	1.00
R1693:Aox1	UTSW	1	58085542	missense	probably damaging	1.00
R1709:Aox1	UTSW	1	58077474	missense	probably benign
R1869:Aox1	UTSW	1	58076103	missense	probably damaging	1.00
R1870:Aox1	UTSW	1	58076103	missense	probably damaging	1.00
R1898:Aox1	UTSW	1	58078442	missense	probably damaging	1.00
R1908:Aox1	UTSW	1	58102624	missense	probably damaging	1.00
R2002:Aox1	UTSW	1	58047141	missense	possibly damaging	0.69
R2062:Aox1	UTSW	1	58059192	splice site	probably null
R2065:Aox1	UTSW	1	58059192	splice site	probably null
R2265:Aox1	UTSW	1	58081520	missense	probably damaging	0.99
R3713:Aox1	UTSW	1	58056215	missense	probably benign	0.01
R3778:Aox1	UTSW	1	58053703	missense	possibly damaging	0.89
R4198:Aox1	UTSW	1	58085607	missense	probably benign
R4296:Aox1	UTSW	1	58057400	splice site	probably null
R4562:Aox1	UTSW	1	58059056	missense	probably damaging	0.99
R4858:Aox1	UTSW	1	58104481	missense	probably benign
R4862:Aox1	UTSW	1	58095157	missense	probably damaging	0.98
R5048:Aox1	UTSW	1	58059482	splice site	probably benign
R5127:Aox1	UTSW	1	58030026	missense	probably benign	0.00
R5139:Aox1	UTSW	1	58061297	missense	probably benign	0.03
R5157:Aox1	UTSW	1	58070063	missense	probably damaging	1.00
R5168:Aox1	UTSW	1	58049402	missense	probably damaging	1.00
R5186:Aox1	UTSW	1	58068370	missense	probably damaging	1.00
R5235:Aox1	UTSW	1	58057555	missense	possibly damaging	0.77
R5289:Aox1	UTSW	1	58092558	missense	probably damaging	0.99
R5466:Aox1	UTSW	1	58041460	missense	probably damaging	1.00
R5540:Aox1	UTSW	1	58104410	missense	probably benign	0.03
R5615:Aox1	UTSW	1	58096966	missense	probably benign
R5652:Aox1	UTSW	1	58095197	missense	probably damaging	1.00
R5920:Aox1	UTSW	1	58049472	missense	probably damaging	1.00
R6008:Aox1	UTSW	1	58077513	missense	probably damaging	1.00
R6073:Aox1	UTSW	1	58104509	critical splice donor site	probably null
R6215:Aox1	UTSW	1	58085461	missense	probably benign
R6403:Aox1	UTSW	1	58068435	missense	probably damaging	1.00
R6440:Aox1	UTSW	1	58094472	missense	probably damaging	1.00
R6601:Aox1	UTSW	1	58063506	missense	probably damaging	1.00
R6608:Aox1	UTSW	1	58057546	missense	probably benign	0.40
R6752:Aox1	UTSW	1	58047239	missense	probably benign	0.00
R6989:Aox1	UTSW	1	58085452	missense	probably damaging	1.00
R7042:Aox1	UTSW	1	58102600	missense	probably damaging	0.99
R7442:Aox1	UTSW	1	58082013	missense	probably damaging	1.00
R7506:Aox1	UTSW	1	58049403	missense	probably damaging	1.00
R7563:Aox1	UTSW	1	58047145	missense	probably benign	0.32
R7589:Aox1	UTSW	1	58041484	missense	probably damaging	1.00
R7735:Aox1	UTSW	1	58068292	missense	probably benign	0.01
R7814:Aox1	UTSW	1	58085467	missense	probably benign
R7876:Aox1	UTSW	1	58062171	nonsense	probably null
R7905:Aox1	UTSW	1	58104398	missense	possibly damaging	0.72
R7908:Aox1	UTSW	1	58106068	missense	possibly damaging	0.68
R8116:Aox1	UTSW	1	58076124	missense	probably damaging	1.00
R8179:Aox1	UTSW	1	58097958	missense	probably damaging	1.00
R8284:Aox1	UTSW	1	58076091	missense	probably damaging	1.00
R8415:Aox1	UTSW	1	58041479	missense	probably damaging	1.00
R8946:Aox1	UTSW	1	58106068	missense	possibly damaging	0.68
R8988:Aox1	UTSW	1	58049466	missense	possibly damaging	0.48
R9296:Aox1	UTSW	1	58085453	missense	probably damaging	1.00
R9382:Aox1	UTSW	1	58065342	missense	possibly damaging	0.48
R9461:Aox1	UTSW	1	58077577	critical splice donor site	probably null
Z1088:Aox1	UTSW	1	58081542	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGGCCATCTGTCACAAGAC -3'
(R):5'- AGATGCTCACAGCTTGATGC -3'

Sequencing Primer
(F):5'- TCAGGACTCTTGACTTAAATATCCC -3'
(R):5'- CTCCAGGCAGTGAGGTGATG -3'

Posted On

2020-07-28