Incidental Mutation 'R8264:G530012D18Rik'
ID 639708
Institutional Source Beutler Lab
Gene Symbol G530012D18Rik
Ensembl Gene ENSMUSG00000094127
Gene Name RIKEN cDNA G530012D1 gene
Synonyms
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R8264 (G1)
Quality Score 109.008
Status Validated
Chromosome 1
Chromosomal Location 85503397-85505016 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 85504935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 113 (D113E)
Ref Sequence ENSEMBL: ENSMUSP00000136816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]
AlphaFold J3QK25
Predicted Effect probably benign
Transcript: ENSMUST00000093508
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178024
AA Change: D113E
SMART Domains Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127
AA Change: D113E

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 82 122 N/A INTRINSIC
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in G530012D18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB001:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
BB003:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
BB005:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
BB006:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
BB011:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
BB013:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
BB015:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
BB016:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
FR4340:G530012D18Rik UTSW 1 85,504,873 (GRCm39) small deletion probably benign
FR4449:G530012D18Rik UTSW 1 85,504,901 (GRCm39) small deletion probably benign
FR4737:G530012D18Rik UTSW 1 85,504,899 (GRCm39) frame shift probably null
IGL03050:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
PIT4142001:G530012D18Rik UTSW 1 85,504,925 (GRCm39) utr 3 prime probably benign
R0707:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R0730:G530012D18Rik UTSW 1 85,504,757 (GRCm39) utr 3 prime probably benign
R0819:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R1053:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R1155:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R1236:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R1245:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R1880:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R1961:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R2033:G530012D18Rik UTSW 1 85,504,875 (GRCm39) frame shift probably null
R2055:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R2510:G530012D18Rik UTSW 1 85,504,925 (GRCm39) utr 3 prime probably benign
R2903:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R2989:G530012D18Rik UTSW 1 85,504,937 (GRCm39) frame shift probably null
R3000:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R3757:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R3914:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
R4358:G530012D18Rik UTSW 1 85,504,923 (GRCm39) utr 3 prime probably benign
R4407:G530012D18Rik UTSW 1 85,504,923 (GRCm39) utr 3 prime probably benign
R4417:G530012D18Rik UTSW 1 85,504,923 (GRCm39) utr 3 prime probably benign
R5086:G530012D18Rik UTSW 1 85,504,941 (GRCm39) utr 3 prime probably benign
R5389:G530012D18Rik UTSW 1 85,504,923 (GRCm39) utr 3 prime probably benign
R7212:G530012D18Rik UTSW 1 85,504,864 (GRCm39) missense unknown
R7823:G530012D18Rik UTSW 1 85,504,923 (GRCm39) utr 3 prime probably benign
R7924:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R7926:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R7927:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R7928:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R7929:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R8162:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R8163:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R8164:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R8263:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R8265:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R8491:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R8492:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R8524:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R8742:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
R8744:G530012D18Rik UTSW 1 85,504,935 (GRCm39) missense unknown
X0023:G530012D18Rik UTSW 1 85,504,945 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACATCGTGAGCGTGTACCAC -3'
(R):5'- ACAGGTGTTTCCTAAAGGGG -3'

Sequencing Primer
(F):5'- TGTACCACAGTGCTGGGTCAG -3'
(R):5'- GGGGGAAACATCAATATTCACAAG -3'
Posted On 2020-07-28