Incidental Mutation 'R8264:Map3k19'
ID 639709
Institutional Source Beutler Lab
Gene Symbol Map3k19
Ensembl Gene ENSMUSG00000051590
Gene Name mitogen-activated protein kinase kinase kinase 19
Synonyms Ysk4
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 127742528-127782768 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127751528 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 303 (I303F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]
AlphaFold E9Q3S4
Predicted Effect possibly damaging
Transcript: ENSMUST00000061512
AA Change: I404F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: I404F

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: I303F

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189398
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191333
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208183
AA Change: I608F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Map3k19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Map3k19 APN 1 127,752,068 (GRCm39) nonsense probably null
IGL01367:Map3k19 APN 1 127,752,088 (GRCm39) missense possibly damaging 0.88
IGL01443:Map3k19 APN 1 127,766,244 (GRCm39) missense probably benign 0.38
IGL01481:Map3k19 APN 1 127,750,215 (GRCm39) missense probably damaging 0.99
IGL01530:Map3k19 APN 1 127,749,841 (GRCm39) missense probably damaging 1.00
IGL01603:Map3k19 APN 1 127,758,010 (GRCm39) missense possibly damaging 0.89
IGL02044:Map3k19 APN 1 127,751,242 (GRCm39) missense probably damaging 1.00
IGL02159:Map3k19 APN 1 127,750,907 (GRCm39) missense probably benign 0.00
IGL02296:Map3k19 APN 1 127,751,983 (GRCm39) missense probably damaging 1.00
IGL02349:Map3k19 APN 1 127,751,506 (GRCm39) missense possibly damaging 0.48
IGL02823:Map3k19 APN 1 127,750,001 (GRCm39) missense probably benign 0.01
IGL02965:Map3k19 APN 1 127,751,803 (GRCm39) missense probably damaging 0.98
IGL03137:Map3k19 APN 1 127,752,052 (GRCm39) missense probably benign 0.04
R0125:Map3k19 UTSW 1 127,750,837 (GRCm39) missense probably benign 0.07
R0265:Map3k19 UTSW 1 127,749,919 (GRCm39) missense possibly damaging 0.61
R0389:Map3k19 UTSW 1 127,750,152 (GRCm39) missense probably benign 0.08
R0443:Map3k19 UTSW 1 127,750,152 (GRCm39) missense probably benign 0.08
R0465:Map3k19 UTSW 1 127,766,264 (GRCm39) missense probably damaging 1.00
R0645:Map3k19 UTSW 1 127,749,919 (GRCm39) missense possibly damaging 0.61
R0759:Map3k19 UTSW 1 127,745,162 (GRCm39) missense possibly damaging 0.90
R0815:Map3k19 UTSW 1 127,762,375 (GRCm39) splice site probably benign
R0838:Map3k19 UTSW 1 127,751,696 (GRCm39) missense probably benign 0.13
R1173:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1174:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1175:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1457:Map3k19 UTSW 1 127,745,635 (GRCm39) missense probably damaging 1.00
R1661:Map3k19 UTSW 1 127,745,393 (GRCm39) missense possibly damaging 0.95
R1665:Map3k19 UTSW 1 127,745,393 (GRCm39) missense possibly damaging 0.95
R1753:Map3k19 UTSW 1 127,750,417 (GRCm39) missense probably benign 0.02
R1944:Map3k19 UTSW 1 127,750,859 (GRCm39) missense probably benign 0.29
R2496:Map3k19 UTSW 1 127,750,823 (GRCm39) missense probably damaging 1.00
R2878:Map3k19 UTSW 1 127,751,530 (GRCm39) missense possibly damaging 0.61
R2895:Map3k19 UTSW 1 127,749,835 (GRCm39) missense possibly damaging 0.60
R3025:Map3k19 UTSW 1 127,766,290 (GRCm39) critical splice acceptor site probably null
R4577:Map3k19 UTSW 1 127,750,550 (GRCm39) nonsense probably null
R4612:Map3k19 UTSW 1 127,743,037 (GRCm39) missense probably benign 0.07
R4888:Map3k19 UTSW 1 127,745,470 (GRCm39) missense probably damaging 1.00
R4927:Map3k19 UTSW 1 127,749,932 (GRCm39) missense probably benign 0.08
R5028:Map3k19 UTSW 1 127,750,969 (GRCm39) missense probably benign 0.00
R5050:Map3k19 UTSW 1 127,751,299 (GRCm39) missense probably benign 0.21
R5131:Map3k19 UTSW 1 127,751,427 (GRCm39) missense possibly damaging 0.78
R5556:Map3k19 UTSW 1 127,762,284 (GRCm39) nonsense probably null
R5606:Map3k19 UTSW 1 127,750,694 (GRCm39) missense probably benign
R5617:Map3k19 UTSW 1 127,750,703 (GRCm39) missense probably damaging 1.00
R5755:Map3k19 UTSW 1 127,750,118 (GRCm39) missense probably benign 0.02
R5854:Map3k19 UTSW 1 127,758,092 (GRCm39) missense probably damaging 0.96
R5952:Map3k19 UTSW 1 127,750,477 (GRCm39) missense probably benign 0.01
R6132:Map3k19 UTSW 1 127,778,213 (GRCm39) missense possibly damaging 0.53
R6175:Map3k19 UTSW 1 127,750,569 (GRCm39) missense probably benign 0.05
R6261:Map3k19 UTSW 1 127,750,336 (GRCm39) missense possibly damaging 0.95
R6471:Map3k19 UTSW 1 127,744,991 (GRCm39) missense probably damaging 1.00
R6726:Map3k19 UTSW 1 127,748,185 (GRCm39) missense probably benign 0.09
R6732:Map3k19 UTSW 1 127,751,969 (GRCm39) missense probably benign 0.37
R6762:Map3k19 UTSW 1 127,775,001 (GRCm39) missense probably damaging 1.00
R7366:Map3k19 UTSW 1 127,745,192 (GRCm39) missense probably damaging 1.00
R7414:Map3k19 UTSW 1 127,766,189 (GRCm39) missense probably damaging 0.99
R7686:Map3k19 UTSW 1 127,749,985 (GRCm39) nonsense probably null
R7702:Map3k19 UTSW 1 127,756,827 (GRCm39) missense probably damaging 1.00
R7849:Map3k19 UTSW 1 127,751,383 (GRCm39) missense probably benign 0.21
R8129:Map3k19 UTSW 1 127,750,420 (GRCm39) missense possibly damaging 0.90
R8134:Map3k19 UTSW 1 127,751,492 (GRCm39) missense probably damaging 0.99
R8136:Map3k19 UTSW 1 127,751,492 (GRCm39) missense probably damaging 0.99
R8305:Map3k19 UTSW 1 127,745,007 (GRCm39) missense
R8511:Map3k19 UTSW 1 127,775,155 (GRCm39) missense possibly damaging 0.71
R8808:Map3k19 UTSW 1 127,751,866 (GRCm39) missense probably damaging 1.00
R8913:Map3k19 UTSW 1 127,750,363 (GRCm39) missense probably benign 0.08
R9025:Map3k19 UTSW 1 127,758,175 (GRCm39) missense probably benign 0.06
R9593:Map3k19 UTSW 1 127,778,163 (GRCm39) missense probably benign 0.01
R9681:Map3k19 UTSW 1 127,750,097 (GRCm39) missense possibly damaging 0.61
Z1177:Map3k19 UTSW 1 127,749,771 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCCAGGGAATGCGATGTGAG -3'
(R):5'- GGTACCATGTTAGTGAGATGCAAAG -3'

Sequencing Primer
(F):5'- ATGTGAGTAAGCGGCACCACC -3'
(R):5'- CATGTTAGTGAGATGCAAAGAGGGG -3'
Posted On 2020-07-28