Incidental Mutation 'R8264:Map3k19'
ID 639709
Institutional Source Beutler Lab
Gene Symbol Map3k19
Ensembl Gene ENSMUSG00000051590
Gene Name mitogen-activated protein kinase kinase kinase 19
Synonyms Ysk4
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.179) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 127815253-127855031 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127823791 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 303 (I303F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]
AlphaFold E9Q3S4
Predicted Effect possibly damaging
Transcript: ENSMUST00000061512
AA Change: I404F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: I404F

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: I303F

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189398
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191333
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208183
AA Change: I608F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,782 C911S probably damaging Het
Abcc4 T A 14: 118,594,842 N792I possibly damaging Het
Acacb A T 5: 114,207,366 H960L probably benign Het
Aox1 A G 1: 58,053,714 T162A possibly damaging Het
Cacna1g T C 11: 94,473,566 S18G probably benign Het
Chfr T A 5: 110,152,434 I348N possibly damaging Het
Cntln G A 4: 85,098,411 R12Q probably damaging Het
Cyp2c40 A G 19: 39,807,527 S136P possibly damaging Het
Dnah14 T A 1: 181,744,792 M2896K probably damaging Het
Elp6 A G 9: 110,319,687 T215A probably damaging Het
Esyt2 A C 12: 116,365,920 Q699H probably benign Het
Fbxo25 A G 8: 13,929,393 T204A possibly damaging Het
Fhdc1 A G 3: 84,455,032 S294P probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Galnt10 A G 11: 57,782,206 I463V probably benign Het
Glce A G 9: 62,060,430 F480L probably benign Het
H2-Aa A G 17: 34,287,735 V11A probably benign Het
Hsd17b4 A G 18: 50,146,526 T191A possibly damaging Het
Itpr3 G T 17: 27,104,112 silent Het
Izumo4 G T 10: 80,702,738 G8V Het
Klk1b5 T A 7: 44,220,030 L178H probably damaging Het
Lama2 T C 10: 27,467,222 N85D probably benign Het
Liph A C 16: 21,983,971 I116R possibly damaging Het
Lpar5 T A 6: 125,081,502 V62D probably damaging Het
Mymk A G 2: 27,067,856 probably benign Het
Myo10 G A 15: 25,800,109 V1424M probably damaging Het
Myof T G 19: 37,921,433 Q1528P probably damaging Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Nup214 T A 2: 31,994,726 Y500N possibly damaging Het
Olfr1040 T C 2: 86,146,194 D180G probably damaging Het
Papd4 C T 13: 93,175,569 G208S probably damaging Het
Pappa2 T C 1: 158,854,973 Y835C probably damaging Het
Pcdh18 T C 3: 49,756,581 E95G probably damaging Het
Phf3 A T 1: 30,831,057 N303K possibly damaging Het
Pnn C T 12: 59,072,577 H649Y unknown Het
Rab11fip1 G A 8: 27,152,480 Q764* probably null Het
Ralgapa2 A T 2: 146,333,450 M1762K possibly damaging Het
Rif1 G A 2: 52,090,278 A496T noncoding transcript Het
Rnase13 A T 14: 51,922,457 V75D probably damaging Het
Sema3c G A 5: 17,676,539 probably benign Het
Sema4c C G 1: 36,552,885 G266R probably damaging Het
Slfn5 A T 11: 82,956,550 D87V probably damaging Het
Smpd3 T C 8: 106,264,658 Y421C probably damaging Het
Snrnp40 T C 4: 130,378,074 V188A probably benign Het
Srms A G 2: 181,212,550 Y75H probably benign Het
Tex15 T C 8: 33,582,362 S2646P probably benign Het
Togaram1 A G 12: 64,995,556 I1130V probably benign Het
Ttf1 A G 2: 29,064,677 K18E possibly damaging Het
Unc5b G T 10: 60,768,334 T827K probably benign Het
Zfhx2 T A 14: 55,065,512 T1672S possibly damaging Het
Other mutations in Map3k19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Map3k19 APN 1 127824331 nonsense probably null
IGL01367:Map3k19 APN 1 127824351 missense possibly damaging 0.88
IGL01443:Map3k19 APN 1 127838507 missense probably benign 0.38
IGL01481:Map3k19 APN 1 127822478 missense probably damaging 0.99
IGL01530:Map3k19 APN 1 127822104 missense probably damaging 1.00
IGL01603:Map3k19 APN 1 127830273 missense possibly damaging 0.89
IGL02044:Map3k19 APN 1 127823505 missense probably damaging 1.00
IGL02159:Map3k19 APN 1 127823170 missense probably benign 0.00
IGL02296:Map3k19 APN 1 127824246 missense probably damaging 1.00
IGL02349:Map3k19 APN 1 127823769 missense possibly damaging 0.48
IGL02823:Map3k19 APN 1 127822264 missense probably benign 0.01
IGL02965:Map3k19 APN 1 127824066 missense probably damaging 0.98
IGL03137:Map3k19 APN 1 127824315 missense probably benign 0.04
R0125:Map3k19 UTSW 1 127823100 missense probably benign 0.07
R0265:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0389:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0443:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0465:Map3k19 UTSW 1 127838527 missense probably damaging 1.00
R0645:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0759:Map3k19 UTSW 1 127817425 missense possibly damaging 0.90
R0815:Map3k19 UTSW 1 127834638 splice site probably benign
R0838:Map3k19 UTSW 1 127823959 missense probably benign 0.13
R1173:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1174:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1175:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1457:Map3k19 UTSW 1 127817898 missense probably damaging 1.00
R1661:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1665:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1753:Map3k19 UTSW 1 127822680 missense probably benign 0.02
R1944:Map3k19 UTSW 1 127823122 missense probably benign 0.29
R2496:Map3k19 UTSW 1 127823086 missense probably damaging 1.00
R2878:Map3k19 UTSW 1 127823793 missense possibly damaging 0.61
R2895:Map3k19 UTSW 1 127822098 missense possibly damaging 0.60
R3025:Map3k19 UTSW 1 127838553 critical splice acceptor site probably null
R4577:Map3k19 UTSW 1 127822813 nonsense probably null
R4612:Map3k19 UTSW 1 127815300 missense probably benign 0.07
R4888:Map3k19 UTSW 1 127817733 missense probably damaging 1.00
R4927:Map3k19 UTSW 1 127822195 missense probably benign 0.08
R5028:Map3k19 UTSW 1 127823232 missense probably benign 0.00
R5050:Map3k19 UTSW 1 127823562 missense probably benign 0.21
R5131:Map3k19 UTSW 1 127823690 missense possibly damaging 0.78
R5556:Map3k19 UTSW 1 127834547 nonsense probably null
R5606:Map3k19 UTSW 1 127822957 missense probably benign
R5617:Map3k19 UTSW 1 127822966 missense probably damaging 1.00
R5755:Map3k19 UTSW 1 127822381 missense probably benign 0.02
R5854:Map3k19 UTSW 1 127830355 missense probably damaging 0.96
R5952:Map3k19 UTSW 1 127822740 missense probably benign 0.01
R6132:Map3k19 UTSW 1 127850476 missense possibly damaging 0.53
R6175:Map3k19 UTSW 1 127822832 missense probably benign 0.05
R6261:Map3k19 UTSW 1 127822599 missense possibly damaging 0.95
R6471:Map3k19 UTSW 1 127817254 missense probably damaging 1.00
R6726:Map3k19 UTSW 1 127820448 missense probably benign 0.09
R6732:Map3k19 UTSW 1 127824232 missense probably benign 0.37
R6762:Map3k19 UTSW 1 127847264 missense probably damaging 1.00
R7366:Map3k19 UTSW 1 127817455 missense probably damaging 1.00
R7414:Map3k19 UTSW 1 127838452 missense probably damaging 0.99
R7686:Map3k19 UTSW 1 127822248 nonsense probably null
R7702:Map3k19 UTSW 1 127829090 missense probably damaging 1.00
R7849:Map3k19 UTSW 1 127823646 missense probably benign 0.21
R8129:Map3k19 UTSW 1 127822683 missense possibly damaging 0.90
R8134:Map3k19 UTSW 1 127823755 missense probably damaging 0.99
R8136:Map3k19 UTSW 1 127823755 missense probably damaging 0.99
R8305:Map3k19 UTSW 1 127817270 missense
R8511:Map3k19 UTSW 1 127847418 missense possibly damaging 0.71
R8808:Map3k19 UTSW 1 127824129 missense probably damaging 1.00
R8913:Map3k19 UTSW 1 127822626 missense probably benign 0.08
R9025:Map3k19 UTSW 1 127830438 missense probably benign 0.06
R9593:Map3k19 UTSW 1 127850426 missense probably benign 0.01
R9681:Map3k19 UTSW 1 127822360 missense possibly damaging 0.61
Z1177:Map3k19 UTSW 1 127822034 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCCAGGGAATGCGATGTGAG -3'
(R):5'- GGTACCATGTTAGTGAGATGCAAAG -3'

Sequencing Primer
(F):5'- ATGTGAGTAAGCGGCACCACC -3'
(R):5'- CATGTTAGTGAGATGCAAAGAGGGG -3'
Posted On 2020-07-28