Incidental Mutation 'R0691:Fhip2b'
ID 63971
Institutional Source Beutler Lab
Gene Symbol Fhip2b
Ensembl Gene ENSMUSG00000022095
Gene Name FHF complex subunit HOOK interacting protein 2B
Synonyms G430067P06Rik, Fam160b2, Rai16
MMRRC Submission 038876-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R0691 (G1)
Quality Score 115
Status Validated
Chromosome 14
Chromosomal Location 70820736-70837275 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70825727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 351 (D351G)
Ref Sequence ENSEMBL: ENSMUSP00000022690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022690]
AlphaFold Q80YR2
Predicted Effect probably damaging
Transcript: ENSMUST00000022690
AA Change: D351G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022690
Gene: ENSMUSG00000022095
AA Change: D351G

DomainStartEndE-ValueType
Pfam:RAI16-like 79 477 7.7e-112 PFAM
low complexity region 516 528 N/A INTRINSIC
Meta Mutation Damage Score 0.7706 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,584,979 (GRCm39) D865G possibly damaging Het
Acy1 A T 9: 106,313,070 (GRCm39) probably null Het
Adcy4 A T 14: 56,010,104 (GRCm39) probably benign Het
Anpep T G 7: 79,489,047 (GRCm39) D347A probably damaging Het
Arhgap28 C T 17: 68,203,159 (GRCm39) probably null Het
Ccdc32 A G 2: 118,857,610 (GRCm39) probably benign Het
Cdc42bpa A G 1: 179,972,400 (GRCm39) T1401A possibly damaging Het
Celsr2 A G 3: 108,319,939 (GRCm39) Y958H probably damaging Het
Cenpe A G 3: 134,923,066 (GRCm39) E137G probably damaging Het
Chd8 T C 14: 52,450,890 (GRCm39) D1399G probably damaging Het
Cntn3 T C 6: 102,145,908 (GRCm39) T978A possibly damaging Het
Col10a1 A G 10: 34,271,692 (GRCm39) T555A possibly damaging Het
Crybg3 A C 16: 59,385,574 (GRCm39) probably null Het
Cts7 A G 13: 61,503,548 (GRCm39) F139L probably damaging Het
Dera T C 6: 137,773,745 (GRCm39) probably benign Het
Dgka A G 10: 128,559,129 (GRCm39) probably benign Het
Dhrs7 T A 12: 72,699,125 (GRCm39) I286F probably damaging Het
Dtwd2 A G 18: 49,861,424 (GRCm39) probably benign Het
Fermt1 A G 2: 132,748,653 (GRCm39) S657P probably damaging Het
Flnb T C 14: 7,890,810 (GRCm38) V564A probably benign Het
Garnl3 A G 2: 32,975,919 (GRCm39) F16L probably damaging Het
Gck T C 11: 5,856,691 (GRCm39) R191G probably damaging Het
Gucy1b1 A T 3: 81,952,941 (GRCm39) probably benign Het
Ifna2 A C 4: 88,601,895 (GRCm39) L41R probably damaging Het
Krt33a T G 11: 99,903,541 (GRCm39) E197A probably damaging Het
Lce1e G A 3: 92,615,063 (GRCm39) R95C unknown Het
Lct G T 1: 128,235,971 (GRCm39) S345R probably benign Het
Lrp2 A T 2: 69,281,724 (GRCm39) N3882K probably benign Het
Mcc G T 18: 44,578,927 (GRCm39) T652K possibly damaging Het
Mier1 A G 4: 102,996,699 (GRCm39) S109G probably benign Het
Nfat5 A G 8: 108,082,237 (GRCm39) N469S probably damaging Het
Or1e23 C A 11: 73,407,670 (GRCm39) M118I possibly damaging Het
Or6c214 G A 10: 129,591,271 (GRCm39) T16I probably damaging Het
Piwil1 G T 5: 128,820,371 (GRCm39) R256M probably null Het
Rgma T C 7: 73,059,160 (GRCm39) V88A probably damaging Het
Sdk2 T C 11: 113,685,746 (GRCm39) probably null Het
Sec22b A G 3: 97,819,990 (GRCm39) E94G probably damaging Het
Snrnp70 T C 7: 45,036,669 (GRCm39) R131G possibly damaging Het
Spata31d1a A G 13: 59,848,199 (GRCm39) S1310P possibly damaging Het
Spint1 A G 2: 119,076,948 (GRCm39) E344G probably damaging Het
Srrm1 G A 4: 135,052,302 (GRCm39) Q141* probably null Het
Tecta A T 9: 42,295,637 (GRCm39) L286Q probably damaging Het
Tep1 T A 14: 51,104,301 (GRCm39) K198* probably null Het
Tk2 A G 8: 104,957,824 (GRCm39) V174A probably benign Het
Txndc5 T C 13: 38,691,872 (GRCm39) K165E probably damaging Het
Ubr4 G A 4: 139,151,217 (GRCm39) R1884Q probably damaging Het
Vmn2r61 T C 7: 41,949,844 (GRCm39) Y755H probably damaging Het
Xrn1 T A 9: 95,855,592 (GRCm39) H296Q probably damaging Het
Zar1l A T 5: 150,436,407 (GRCm39) V223D probably damaging Het
Other mutations in Fhip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Fhip2b APN 14 70,822,813 (GRCm39) missense probably damaging 1.00
IGL01862:Fhip2b APN 14 70,825,130 (GRCm39) missense probably benign 0.03
IGL02306:Fhip2b APN 14 70,826,437 (GRCm39) missense probably benign
IGL02534:Fhip2b APN 14 70,823,630 (GRCm39) missense probably benign
IGL02534:Fhip2b APN 14 70,823,128 (GRCm39) missense probably damaging 0.98
IGL03071:Fhip2b APN 14 70,823,649 (GRCm39) missense probably damaging 1.00
IGL03162:Fhip2b APN 14 70,824,994 (GRCm39) missense probably damaging 1.00
IGL03166:Fhip2b APN 14 70,827,616 (GRCm39) missense probably damaging 1.00
IGL03134:Fhip2b UTSW 14 70,826,149 (GRCm39) missense possibly damaging 0.66
R0043:Fhip2b UTSW 14 70,826,101 (GRCm39) missense probably benign 0.45
R0628:Fhip2b UTSW 14 70,825,161 (GRCm39) missense possibly damaging 0.48
R1680:Fhip2b UTSW 14 70,824,291 (GRCm39) missense probably damaging 1.00
R1727:Fhip2b UTSW 14 70,831,438 (GRCm39) missense probably damaging 0.98
R2059:Fhip2b UTSW 14 70,822,489 (GRCm39) missense possibly damaging 0.54
R2362:Fhip2b UTSW 14 70,823,805 (GRCm39) missense probably benign 0.18
R3423:Fhip2b UTSW 14 70,824,025 (GRCm39) missense probably damaging 1.00
R4233:Fhip2b UTSW 14 70,824,318 (GRCm39) missense probably damaging 0.99
R4770:Fhip2b UTSW 14 70,825,727 (GRCm39) missense probably damaging 1.00
R5903:Fhip2b UTSW 14 70,829,121 (GRCm39) missense probably damaging 1.00
R6217:Fhip2b UTSW 14 70,829,198 (GRCm39) splice site probably null
R6665:Fhip2b UTSW 14 70,823,078 (GRCm39) missense probably damaging 1.00
R7424:Fhip2b UTSW 14 70,831,447 (GRCm39) missense probably damaging 1.00
R9176:Fhip2b UTSW 14 70,826,540 (GRCm39) missense probably benign 0.40
R9393:Fhip2b UTSW 14 70,831,463 (GRCm39) nonsense probably null
R9486:Fhip2b UTSW 14 70,826,479 (GRCm39) missense probably benign 0.00
R9529:Fhip2b UTSW 14 70,822,579 (GRCm39) missense probably damaging 1.00
R9610:Fhip2b UTSW 14 70,824,258 (GRCm39) missense probably benign 0.44
R9611:Fhip2b UTSW 14 70,824,258 (GRCm39) missense probably benign 0.44
R9646:Fhip2b UTSW 14 70,827,808 (GRCm39) missense probably damaging 0.99
R9699:Fhip2b UTSW 14 70,825,179 (GRCm39) missense possibly damaging 0.90
R9760:Fhip2b UTSW 14 70,827,621 (GRCm39) missense possibly damaging 0.94
Z1176:Fhip2b UTSW 14 70,823,644 (GRCm39) missense not run
Z1177:Fhip2b UTSW 14 70,823,644 (GRCm39) missense not run
Predicted Primers PCR Primer
(F):5'- AGCATGTCTCCTGCATTCAAACCC -3'
(R):5'- GAGCCTCACTTCTGCAATCTGACC -3'

Sequencing Primer
(F):5'- TAGTCACTCCTAAAAAATCCTGTGC -3'
(R):5'- TTCTGCAATCTGACCACAGC -3'
Posted On 2013-07-30