Incidental Mutation 'R0691:Fam160b2'
ID63971
Institutional Source Beutler Lab
Gene Symbol Fam160b2
Ensembl Gene ENSMUSG00000022095
Gene Namefamily with sequence similarity 160, member B2
SynonymsRai16, G430067P06Rik
MMRRC Submission 038876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0691 (G1)
Quality Score115
Status Validated
Chromosome14
Chromosomal Location70583296-70599835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70588287 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 351 (D351G)
Ref Sequence ENSEMBL: ENSMUSP00000022690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022690]
Predicted Effect probably damaging
Transcript: ENSMUST00000022690
AA Change: D351G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022690
Gene: ENSMUSG00000022095
AA Change: D351G

DomainStartEndE-ValueType
Pfam:RAI16-like 79 477 7.7e-112 PFAM
low complexity region 516 528 N/A INTRINSIC
Meta Mutation Damage Score 0.7706 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,253 D865G possibly damaging Het
Acy1 A T 9: 106,435,871 probably null Het
Adcy4 A T 14: 55,772,647 probably benign Het
Anpep T G 7: 79,839,299 D347A probably damaging Het
Arhgap28 C T 17: 67,896,164 probably null Het
Ccdc32 A G 2: 119,027,129 probably benign Het
Cdc42bpa A G 1: 180,144,835 T1401A possibly damaging Het
Celsr2 A G 3: 108,412,623 Y958H probably damaging Het
Cenpe A G 3: 135,217,305 E137G probably damaging Het
Chd8 T C 14: 52,213,433 D1399G probably damaging Het
Cntn3 T C 6: 102,168,947 T978A possibly damaging Het
Col10a1 A G 10: 34,395,696 T555A possibly damaging Het
Crybg3 A C 16: 59,565,211 probably null Het
Cts7 A G 13: 61,355,734 F139L probably damaging Het
Dera T C 6: 137,796,747 probably benign Het
Dgka A G 10: 128,723,260 probably benign Het
Dhrs7 T A 12: 72,652,351 I286F probably damaging Het
Dtwd2 A G 18: 49,728,357 probably benign Het
Fermt1 A G 2: 132,906,733 S657P probably damaging Het
Flnb T C 14: 7,890,810 V564A probably benign Het
Garnl3 A G 2: 33,085,907 F16L probably damaging Het
Gck T C 11: 5,906,691 R191G probably damaging Het
Gucy1b1 A T 3: 82,045,634 probably benign Het
Ifna2 A C 4: 88,683,658 L41R probably damaging Het
Krt33a T G 11: 100,012,715 E197A probably damaging Het
Lce1e G A 3: 92,707,756 R95C unknown Het
Lct G T 1: 128,308,234 S345R probably benign Het
Lrp2 A T 2: 69,451,380 N3882K probably benign Het
Mcc G T 18: 44,445,860 T652K possibly damaging Het
Mier1 A G 4: 103,139,502 S109G probably benign Het
Nfat5 A G 8: 107,355,605 N469S probably damaging Het
Olfr382 C A 11: 73,516,844 M118I possibly damaging Het
Olfr807 G A 10: 129,755,402 T16I probably damaging Het
Piwil1 G T 5: 128,743,307 R256M probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Sdk2 T C 11: 113,794,920 probably null Het
Sec22b A G 3: 97,912,674 E94G probably damaging Het
Snrnp70 T C 7: 45,387,245 R131G possibly damaging Het
Spata31d1a A G 13: 59,700,385 S1310P possibly damaging Het
Spint1 A G 2: 119,246,467 E344G probably damaging Het
Srrm1 G A 4: 135,324,991 Q141* probably null Het
Tecta A T 9: 42,384,341 L286Q probably damaging Het
Tep1 T A 14: 50,866,844 K198* probably null Het
Tk2 A G 8: 104,231,192 V174A probably benign Het
Txndc5 T C 13: 38,507,896 K165E probably damaging Het
Ubr4 G A 4: 139,423,906 R1884Q probably damaging Het
Vmn2r61 T C 7: 42,300,420 Y755H probably damaging Het
Xrn1 T A 9: 95,973,539 H296Q probably damaging Het
Zar1l A T 5: 150,512,942 V223D probably damaging Het
Other mutations in Fam160b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Fam160b2 APN 14 70585373 missense probably damaging 1.00
IGL01862:Fam160b2 APN 14 70587690 missense probably benign 0.03
IGL02306:Fam160b2 APN 14 70588997 missense probably benign
IGL02534:Fam160b2 APN 14 70585688 missense probably damaging 0.98
IGL02534:Fam160b2 APN 14 70586190 missense probably benign
IGL03071:Fam160b2 APN 14 70586209 missense probably damaging 1.00
IGL03162:Fam160b2 APN 14 70587554 missense probably damaging 1.00
IGL03166:Fam160b2 APN 14 70590176 missense probably damaging 1.00
IGL03134:Fam160b2 UTSW 14 70588709 missense possibly damaging 0.66
R0043:Fam160b2 UTSW 14 70588661 missense probably benign 0.45
R0628:Fam160b2 UTSW 14 70587721 missense possibly damaging 0.48
R1680:Fam160b2 UTSW 14 70586851 missense probably damaging 1.00
R1727:Fam160b2 UTSW 14 70593998 missense probably damaging 0.98
R2059:Fam160b2 UTSW 14 70585049 missense possibly damaging 0.54
R2362:Fam160b2 UTSW 14 70586365 missense probably benign 0.18
R3423:Fam160b2 UTSW 14 70586585 missense probably damaging 1.00
R4233:Fam160b2 UTSW 14 70586878 missense probably damaging 0.99
R4770:Fam160b2 UTSW 14 70588287 missense probably damaging 1.00
R5903:Fam160b2 UTSW 14 70591681 missense probably damaging 1.00
R6217:Fam160b2 UTSW 14 70591758 splice site probably null
R6665:Fam160b2 UTSW 14 70585638 missense probably damaging 1.00
R7424:Fam160b2 UTSW 14 70594007 missense probably damaging 1.00
Z1176:Fam160b2 UTSW 14 70586204 missense not run
Z1177:Fam160b2 UTSW 14 70586204 missense not run
Predicted Primers PCR Primer
(F):5'- AGCATGTCTCCTGCATTCAAACCC -3'
(R):5'- GAGCCTCACTTCTGCAATCTGACC -3'

Sequencing Primer
(F):5'- TAGTCACTCCTAAAAAATCCTGTGC -3'
(R):5'- TTCTGCAATCTGACCACAGC -3'
Posted On2013-07-30