Incidental Mutation 'R8264:Mymk'
ID 639712
Institutional Source Beutler Lab
Gene Symbol Mymk
Ensembl Gene ENSMUSG00000009214
Gene Name myomaker, myoblast fusion factor
Synonyms 1110002H13Rik, Tmem8c
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8264 (G1)
Quality Score 111.008
Status Validated
Chromosome 2
Chromosomal Location 26951648-26962173 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) A to G at 26957868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009358] [ENSMUST00000163967]
AlphaFold Q9D1N4
Predicted Effect probably benign
Transcript: ENSMUST00000009358
SMART Domains Protein: ENSMUSP00000009358
Gene: ENSMUSG00000009214

DomainStartEndE-ValueType
Pfam:DUF3522 3 185 1.1e-48 PFAM
low complexity region 196 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163967
SMART Domains Protein: ENSMUSP00000128491
Gene: ENSMUSG00000009214

DomainStartEndE-ValueType
Pfam:DUF3522 4 144 9e-41 PFAM
low complexity region 155 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early postnatal lethality, paralysis, kyphosis and defective myoblast fusion and survival leading to the absence of differentiated muscle in the trunk, limb and head. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Mymk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mymk APN 2 26,952,799 (GRCm39) missense probably damaging 1.00
IGL01947:Mymk APN 2 26,956,406 (GRCm39) missense possibly damaging 0.93
R0173:Mymk UTSW 2 26,952,262 (GRCm39) missense probably damaging 1.00
R0322:Mymk UTSW 2 26,957,418 (GRCm39) missense probably damaging 1.00
R1686:Mymk UTSW 2 26,952,346 (GRCm39) missense probably damaging 1.00
R4583:Mymk UTSW 2 26,952,292 (GRCm39) missense probably benign 0.01
R4610:Mymk UTSW 2 26,952,719 (GRCm39) missense probably damaging 1.00
R5147:Mymk UTSW 2 26,952,299 (GRCm39) missense probably benign 0.14
R5220:Mymk UTSW 2 26,952,226 (GRCm39) missense probably benign 0.00
R5237:Mymk UTSW 2 26,952,200 (GRCm39) makesense probably null
R6189:Mymk UTSW 2 26,957,377 (GRCm39) missense possibly damaging 0.53
R6610:Mymk UTSW 2 26,957,405 (GRCm39) missense possibly damaging 0.94
R7257:Mymk UTSW 2 26,957,380 (GRCm39) missense probably damaging 0.99
R7870:Mymk UTSW 2 26,952,298 (GRCm39) missense probably damaging 0.96
R8507:Mymk UTSW 2 26,952,712 (GRCm39) critical splice donor site probably null
R8784:Mymk UTSW 2 26,961,947 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTTCAGACTCAGCACTGGC -3'
(R):5'- CCAGACAAGGCTGTTTTCCAG -3'

Sequencing Primer
(F):5'- GACTCAGCACTGGCCCAAG -3'
(R):5'- ACCAAGAGCTCATTGTGCTG -3'
Posted On 2020-07-28