Incidental Mutation 'R8264:Nup214'
ID 639714
Institutional Source Beutler Lab
Gene Symbol Nup214
Ensembl Gene ENSMUSG00000001855
Gene Name nucleoporin 214
Synonyms CAN, D2H9S46E
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 31864446-31943204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31884738 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 500 (Y500N)
Ref Sequence ENSEMBL: ENSMUSP00000066492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000126301]
AlphaFold Q80U93
Predicted Effect possibly damaging
Transcript: ENSMUST00000065398
AA Change: Y500N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: Y500N

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126301
SMART Domains Protein: ENSMUSP00000141436
Gene: ENSMUSG00000001855

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Meta Mutation Damage Score 0.1807 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Nup214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nup214 APN 2 31,923,991 (GRCm39) missense probably damaging 1.00
IGL00649:Nup214 APN 2 31,896,733 (GRCm39) missense probably benign 0.27
IGL01149:Nup214 APN 2 31,924,712 (GRCm39) missense probably damaging 1.00
IGL01360:Nup214 APN 2 31,928,190 (GRCm39) unclassified probably benign
IGL01409:Nup214 APN 2 31,916,943 (GRCm39) splice site probably null
IGL01530:Nup214 APN 2 31,923,733 (GRCm39) missense probably benign
IGL01554:Nup214 APN 2 31,941,084 (GRCm39) nonsense probably null
IGL01944:Nup214 APN 2 31,924,971 (GRCm39) nonsense probably null
IGL02296:Nup214 APN 2 31,878,200 (GRCm39) missense possibly damaging 0.65
IGL02563:Nup214 APN 2 31,867,872 (GRCm39) missense probably damaging 1.00
IGL02688:Nup214 APN 2 31,921,287 (GRCm39) missense probably benign
IGL02858:Nup214 APN 2 31,900,384 (GRCm39) splice site probably benign
IGL02953:Nup214 APN 2 31,878,241 (GRCm39) missense possibly damaging 0.87
IGL03090:Nup214 APN 2 31,908,254 (GRCm39) missense probably benign 0.01
IGL03124:Nup214 APN 2 31,886,452 (GRCm39) missense probably benign 0.27
IGL03225:Nup214 APN 2 31,924,423 (GRCm39) missense probably damaging 1.00
IGL03375:Nup214 APN 2 31,900,233 (GRCm39) missense probably damaging 0.97
Des_moines UTSW 2 31,870,596 (GRCm39) splice site probably null
ANU74:Nup214 UTSW 2 31,924,978 (GRCm39) missense probably damaging 0.99
R0035:Nup214 UTSW 2 31,880,379 (GRCm39) splice site probably null
R0243:Nup214 UTSW 2 31,888,069 (GRCm39) splice site probably benign
R0270:Nup214 UTSW 2 31,924,826 (GRCm39) missense probably damaging 0.96
R0358:Nup214 UTSW 2 31,894,312 (GRCm39) splice site probably null
R1168:Nup214 UTSW 2 31,915,313 (GRCm39) missense probably benign
R1242:Nup214 UTSW 2 31,867,782 (GRCm39) missense probably benign 0.00
R1481:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1482:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1579:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1580:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1581:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1610:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1894:Nup214 UTSW 2 31,886,392 (GRCm39) missense possibly damaging 0.66
R2146:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R2149:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R2293:Nup214 UTSW 2 31,916,887 (GRCm39) missense probably benign
R2924:Nup214 UTSW 2 31,888,015 (GRCm39) missense probably damaging 1.00
R2925:Nup214 UTSW 2 31,888,015 (GRCm39) missense probably damaging 1.00
R3037:Nup214 UTSW 2 31,866,632 (GRCm39) missense probably benign 0.00
R3426:Nup214 UTSW 2 31,923,415 (GRCm39) missense probably damaging 0.97
R3799:Nup214 UTSW 2 31,924,694 (GRCm39) missense probably damaging 1.00
R3843:Nup214 UTSW 2 31,941,112 (GRCm39) missense probably damaging 1.00
R4323:Nup214 UTSW 2 31,884,696 (GRCm39) missense probably benign
R4353:Nup214 UTSW 2 31,867,929 (GRCm39) critical splice donor site probably null
R4601:Nup214 UTSW 2 31,887,977 (GRCm39) missense probably benign 0.36
R4626:Nup214 UTSW 2 31,923,416 (GRCm39) missense possibly damaging 0.92
R4874:Nup214 UTSW 2 31,870,596 (GRCm39) splice site probably null
R4938:Nup214 UTSW 2 31,873,171 (GRCm39) missense probably benign 0.00
R4939:Nup214 UTSW 2 31,873,171 (GRCm39) missense probably benign 0.00
R5027:Nup214 UTSW 2 31,881,329 (GRCm39) missense probably damaging 1.00
R5358:Nup214 UTSW 2 31,907,158 (GRCm39) missense unknown
R5406:Nup214 UTSW 2 31,892,619 (GRCm39) missense probably damaging 0.96
R5507:Nup214 UTSW 2 31,878,188 (GRCm39) missense possibly damaging 0.87
R5695:Nup214 UTSW 2 31,924,385 (GRCm39) missense probably damaging 1.00
R5744:Nup214 UTSW 2 31,900,308 (GRCm39) missense probably damaging 0.97
R5908:Nup214 UTSW 2 31,881,353 (GRCm39) missense probably benign 0.03
R5967:Nup214 UTSW 2 31,869,790 (GRCm39) missense possibly damaging 0.52
R6140:Nup214 UTSW 2 31,941,808 (GRCm39) missense possibly damaging 0.92
R6243:Nup214 UTSW 2 31,892,944 (GRCm39) missense possibly damaging 0.81
R6488:Nup214 UTSW 2 31,881,384 (GRCm39) missense possibly damaging 0.93
R6934:Nup214 UTSW 2 31,872,683 (GRCm39) nonsense probably null
R6970:Nup214 UTSW 2 31,941,810 (GRCm39) missense probably damaging 1.00
R7028:Nup214 UTSW 2 31,924,168 (GRCm39) missense probably benign 0.22
R7114:Nup214 UTSW 2 31,915,256 (GRCm39) missense possibly damaging 0.83
R7120:Nup214 UTSW 2 31,941,054 (GRCm39) missense probably benign 0.07
R7249:Nup214 UTSW 2 31,878,245 (GRCm39) missense possibly damaging 0.92
R7821:Nup214 UTSW 2 31,916,917 (GRCm39) missense possibly damaging 0.83
R8026:Nup214 UTSW 2 31,923,362 (GRCm39) missense possibly damaging 0.55
R8284:Nup214 UTSW 2 31,886,458 (GRCm39) missense possibly damaging 0.83
R8356:Nup214 UTSW 2 31,929,372 (GRCm39) missense probably benign 0.05
R8397:Nup214 UTSW 2 31,880,266 (GRCm39) missense probably damaging 0.96
R8456:Nup214 UTSW 2 31,929,372 (GRCm39) missense probably benign 0.05
R8785:Nup214 UTSW 2 31,924,465 (GRCm39) missense probably damaging 0.97
R9257:Nup214 UTSW 2 31,923,347 (GRCm39) missense possibly damaging 0.92
R9291:Nup214 UTSW 2 31,867,806 (GRCm39) missense probably benign 0.00
R9376:Nup214 UTSW 2 31,924,244 (GRCm39) missense probably benign 0.00
R9408:Nup214 UTSW 2 31,937,523 (GRCm39) missense probably damaging 1.00
R9613:Nup214 UTSW 2 31,901,035 (GRCm39) missense possibly damaging 0.90
R9789:Nup214 UTSW 2 31,907,227 (GRCm39) missense possibly damaging 0.46
RF015:Nup214 UTSW 2 31,924,718 (GRCm39) missense probably benign 0.00
X0026:Nup214 UTSW 2 31,910,318 (GRCm39) missense possibly damaging 0.46
X0065:Nup214 UTSW 2 31,932,488 (GRCm39) missense probably damaging 1.00
Z1088:Nup214 UTSW 2 31,901,235 (GRCm39) missense probably benign 0.27
Z1176:Nup214 UTSW 2 31,924,237 (GRCm39) nonsense probably null
Z1176:Nup214 UTSW 2 31,900,270 (GRCm39) missense possibly damaging 0.66
Z1177:Nup214 UTSW 2 31,887,971 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCTTGGTTCTCGTTACAGGAAG -3'
(R):5'- ACTGGACATAGGTGTGCTTTCC -3'

Sequencing Primer
(F):5'- GGTTCTCGTTACAGGAAGTTTTC -3'
(R):5'- GCTTTCCAAGGTGGGCTTAAAACC -3'
Posted On 2020-07-28