Incidental Mutation 'R8264:Ralgapa2'
ID 639717
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene Name Ral GTPase activating protein, alpha subunit 2 (catalytic)
Synonyms AS250, A230067G21Rik, RGC2
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.250) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 146081799-146354264 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 146175370 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1762 (M1762K)
Ref Sequence ENSEMBL: ENSMUSP00000105613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824]
AlphaFold A3KGS3
Predicted Effect possibly damaging
Transcript: ENSMUST00000109986
AA Change: M1762K

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: M1762K

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131824
AA Change: M1724K

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: M1724K

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114547
Gene: ENSMUSG00000037110
AA Change: M750K

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 285 290 N/A INTRINSIC
Pfam:Rap_GAP 690 830 4.9e-39 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: M1394K

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 929 934 N/A INTRINSIC
Pfam:Rap_GAP 1334 1511 2.4e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146,327,056 (GRCm39) missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146,184,442 (GRCm39) missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146,263,659 (GRCm39) missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146,252,112 (GRCm39) missense probably benign 0.00
IGL01018:Ralgapa2 APN 2 146,252,113 (GRCm39) missense probably benign 0.02
IGL01902:Ralgapa2 APN 2 146,156,934 (GRCm39) missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146,190,360 (GRCm39) splice site probably benign
IGL02321:Ralgapa2 APN 2 146,254,736 (GRCm39) nonsense probably null
IGL02412:Ralgapa2 APN 2 146,254,052 (GRCm39) missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146,302,695 (GRCm39) splice site probably benign
IGL03115:Ralgapa2 APN 2 146,266,734 (GRCm39) missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146,302,632 (GRCm39) critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146,199,907 (GRCm39) missense probably benign 0.01
Chow UTSW 2 146,188,638 (GRCm39) nonsense probably null
purina UTSW 2 146,175,406 (GRCm39) missense probably damaging 1.00
P4748:Ralgapa2 UTSW 2 146,188,731 (GRCm39) nonsense probably null
R0012:Ralgapa2 UTSW 2 146,254,672 (GRCm39) missense probably benign
R0012:Ralgapa2 UTSW 2 146,254,672 (GRCm39) missense probably benign
R0165:Ralgapa2 UTSW 2 146,230,407 (GRCm39) splice site probably benign
R0344:Ralgapa2 UTSW 2 146,188,714 (GRCm39) missense possibly damaging 0.69
R0402:Ralgapa2 UTSW 2 146,276,729 (GRCm39) missense probably damaging 0.98
R0419:Ralgapa2 UTSW 2 146,270,592 (GRCm39) missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146,184,112 (GRCm39) missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146,293,704 (GRCm39) missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146,230,451 (GRCm39) missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146,277,923 (GRCm39) missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146,292,478 (GRCm39) missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146,199,902 (GRCm39) missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146,230,420 (GRCm39) missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146,230,532 (GRCm39) missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146,199,920 (GRCm39) missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146,184,648 (GRCm39) missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146,229,621 (GRCm39) missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146,302,679 (GRCm39) missense probably benign 0.00
R2144:Ralgapa2 UTSW 2 146,230,524 (GRCm39) missense probably damaging 1.00
R2148:Ralgapa2 UTSW 2 146,273,807 (GRCm39) missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146,263,599 (GRCm39) missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146,263,599 (GRCm39) missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146,184,603 (GRCm39) missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146,195,112 (GRCm39) missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146,203,320 (GRCm39) missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146,263,551 (GRCm39) missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146,277,884 (GRCm39) missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146,277,884 (GRCm39) missense probably damaging 1.00
R4177:Ralgapa2 UTSW 2 146,327,083 (GRCm39) missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146,277,914 (GRCm39) missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146,184,493 (GRCm39) missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146,102,288 (GRCm39) missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146,195,168 (GRCm39) missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146,277,919 (GRCm39) missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146,156,944 (GRCm39) missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146,203,373 (GRCm39) missense possibly damaging 0.88
R4647:Ralgapa2 UTSW 2 146,229,549 (GRCm39) missense possibly damaging 0.69
R4677:Ralgapa2 UTSW 2 146,187,387 (GRCm39) missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146,187,453 (GRCm39) missense possibly damaging 0.46
R4760:Ralgapa2 UTSW 2 146,188,669 (GRCm39) missense probably benign 0.00
R4831:Ralgapa2 UTSW 2 146,246,987 (GRCm39) intron probably benign
R4962:Ralgapa2 UTSW 2 146,276,754 (GRCm39) nonsense probably null
R4993:Ralgapa2 UTSW 2 146,289,231 (GRCm39) missense probably damaging 1.00
R5041:Ralgapa2 UTSW 2 146,327,071 (GRCm39) missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146,254,004 (GRCm39) missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146,230,406 (GRCm39) splice site probably null
R5393:Ralgapa2 UTSW 2 146,187,375 (GRCm39) missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146,176,414 (GRCm39) missense probably damaging 0.96
R5439:Ralgapa2 UTSW 2 146,184,430 (GRCm39) missense probably benign 0.08
R5476:Ralgapa2 UTSW 2 146,289,356 (GRCm39) missense probably benign
R5695:Ralgapa2 UTSW 2 146,175,397 (GRCm39) missense probably damaging 1.00
R5705:Ralgapa2 UTSW 2 146,291,193 (GRCm39) missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146,295,326 (GRCm39) splice site probably null
R5817:Ralgapa2 UTSW 2 146,175,406 (GRCm39) missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146,230,489 (GRCm39) missense probably damaging 1.00
R5994:Ralgapa2 UTSW 2 146,203,373 (GRCm39) missense probably benign 0.00
R6048:Ralgapa2 UTSW 2 146,276,765 (GRCm39) missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146,266,596 (GRCm39) missense possibly damaging 0.69
R6169:Ralgapa2 UTSW 2 146,292,385 (GRCm39) missense probably damaging 1.00
R6280:Ralgapa2 UTSW 2 146,184,129 (GRCm39) missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146,169,331 (GRCm39) missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146,230,422 (GRCm39) missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146,184,621 (GRCm39) missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146,188,638 (GRCm39) nonsense probably null
R7035:Ralgapa2 UTSW 2 146,353,777 (GRCm39) missense probably damaging 1.00
R7167:Ralgapa2 UTSW 2 146,190,374 (GRCm39) missense probably benign
R7186:Ralgapa2 UTSW 2 146,230,406 (GRCm39) splice site probably null
R7252:Ralgapa2 UTSW 2 146,184,671 (GRCm39) critical splice acceptor site probably null
R7266:Ralgapa2 UTSW 2 146,176,488 (GRCm39) missense probably damaging 1.00
R7371:Ralgapa2 UTSW 2 146,189,046 (GRCm39) missense probably benign 0.05
R7432:Ralgapa2 UTSW 2 146,276,776 (GRCm39) missense probably benign 0.41
R7470:Ralgapa2 UTSW 2 146,266,587 (GRCm39) missense probably damaging 1.00
R7663:Ralgapa2 UTSW 2 146,260,335 (GRCm39) missense probably benign 0.01
R7780:Ralgapa2 UTSW 2 146,184,334 (GRCm39) missense probably benign 0.14
R7973:Ralgapa2 UTSW 2 146,230,481 (GRCm39) missense possibly damaging 0.88
R8018:Ralgapa2 UTSW 2 146,182,311 (GRCm39) missense probably damaging 1.00
R8063:Ralgapa2 UTSW 2 146,285,775 (GRCm39) missense probably damaging 1.00
R8070:Ralgapa2 UTSW 2 146,195,199 (GRCm39) missense probably damaging 0.98
R8309:Ralgapa2 UTSW 2 146,246,786 (GRCm39) missense possibly damaging 0.66
R8409:Ralgapa2 UTSW 2 146,086,897 (GRCm39) missense
R8474:Ralgapa2 UTSW 2 146,266,750 (GRCm39) missense probably damaging 1.00
R8487:Ralgapa2 UTSW 2 146,230,463 (GRCm39) missense probably damaging 1.00
R8492:Ralgapa2 UTSW 2 146,184,524 (GRCm39) missense possibly damaging 0.50
R8733:Ralgapa2 UTSW 2 146,266,683 (GRCm39) missense probably damaging 1.00
R8856:Ralgapa2 UTSW 2 146,184,139 (GRCm39) missense probably benign 0.30
R8858:Ralgapa2 UTSW 2 146,102,285 (GRCm39) critical splice donor site probably null
R8862:Ralgapa2 UTSW 2 146,266,731 (GRCm39) missense probably benign 0.41
R9146:Ralgapa2 UTSW 2 146,184,252 (GRCm39) missense probably benign
R9324:Ralgapa2 UTSW 2 146,302,645 (GRCm39) missense probably damaging 1.00
R9439:Ralgapa2 UTSW 2 146,254,058 (GRCm39) missense probably benign
R9457:Ralgapa2 UTSW 2 146,176,474 (GRCm39) missense probably damaging 0.99
RF019:Ralgapa2 UTSW 2 146,203,423 (GRCm39) missense possibly damaging 0.53
X0019:Ralgapa2 UTSW 2 146,230,572 (GRCm39) missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146,276,825 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GGCCTTAAAGTTGTGCTAAGTTAG -3'
(R):5'- CCCACTCCTGCTTAATGAATAAGG -3'

Sequencing Primer
(F):5'- TGCTAAGTTAGTGGTTTAGATTCAC -3'
(R):5'- GAATAAGGTTAGCTCACTTTTGACCC -3'
Posted On 2020-07-28