Incidental Mutation 'R8264:1110002E22Rik'
ID639721
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R8264 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138067782 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 911 (C911S)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: C911S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: C911S

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Meta Mutation Damage Score 0.1568 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T A 14: 118,594,842 N792I possibly damaging Het
Acacb A T 5: 114,207,366 H960L probably benign Het
Aox1 A G 1: 58,053,714 T162A possibly damaging Het
Cacna1g T C 11: 94,473,566 S18G probably benign Het
Chfr T A 5: 110,152,434 I348N possibly damaging Het
Cntln G A 4: 85,098,411 R12Q probably damaging Het
Cyp2c40 A G 19: 39,807,527 S136P possibly damaging Het
Dnah14 T A 1: 181,744,792 M2896K probably damaging Het
Elp6 A G 9: 110,319,687 T215A probably damaging Het
Esyt2 A C 12: 116,365,920 Q699H probably benign Het
Fam179b A G 12: 64,995,556 I1130V probably benign Het
Fbxo25 A G 8: 13,929,393 T204A possibly damaging Het
Fhdc1 A G 3: 84,455,032 S294P probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Galnt10 A G 11: 57,782,206 I463V probably benign Het
Glce A G 9: 62,060,430 F480L probably benign Het
H2-Aa A G 17: 34,287,735 V11A probably benign Het
Hsd17b4 A G 18: 50,146,526 T191A possibly damaging Het
Itpr3 G T 17: 27,104,112 silent Het
Izumo4 G T 10: 80,702,738 G8V Het
Klk1b5 T A 7: 44,220,030 L178H probably damaging Het
Lama2 T C 10: 27,467,222 N85D probably benign Het
Liph A C 16: 21,983,971 I116R possibly damaging Het
Lpar5 T A 6: 125,081,502 V62D probably damaging Het
Map3k19 T A 1: 127,823,791 I303F Het
Myo10 G A 15: 25,800,109 V1424M probably damaging Het
Myof T G 19: 37,921,433 Q1528P probably damaging Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Nup214 T A 2: 31,994,726 Y500N possibly damaging Het
Olfr1040 T C 2: 86,146,194 D180G probably damaging Het
Papd4 C T 13: 93,175,569 G208S probably damaging Het
Pappa2 T C 1: 158,854,973 Y835C probably damaging Het
Pcdh18 T C 3: 49,756,581 E95G probably damaging Het
Phf3 A T 1: 30,831,057 N303K possibly damaging Het
Pnn C T 12: 59,072,577 H649Y unknown Het
Rab11fip1 G A 8: 27,152,480 Q764* probably null Het
Ralgapa2 A T 2: 146,333,450 M1762K possibly damaging Het
Rif1 G A 2: 52,090,278 A496T noncoding transcript Het
Rnase13 A T 14: 51,922,457 V75D probably damaging Het
Sema3c G A 5: 17,676,539 probably benign Het
Sema4c C G 1: 36,552,885 G266R probably damaging Het
Slfn5 A T 11: 82,956,550 D87V probably damaging Het
Smpd3 T C 8: 106,264,658 Y421C probably damaging Het
Snrnp40 T C 4: 130,378,074 V188A probably benign Het
Srms A G 2: 181,212,550 Y75H probably benign Het
Tex15 T C 8: 33,582,362 S2646P probably benign Het
Tmem8c A G 2: 27,067,856 probably benign Het
Ttf1 A G 2: 29,064,677 K18E possibly damaging Het
Unc5b G T 10: 60,768,334 T827K probably benign Het
Zfhx2 T A 14: 55,065,512 T1672S possibly damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCACTGATACATCTCACCG -3'
(R):5'- TGGTAGACTTGCTGGCAGAG -3'

Sequencing Primer
(F):5'- GTCACTGATACATCTCACCGTAACC -3'
(R):5'- TAGACTTGCTGGCAGAGATCTCC -3'
Posted On2020-07-28