Incidental Mutation 'R8264:Cntln'
ID 639722
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 85016648 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 12 (R12Q)
Ref Sequence ENSEMBL: ENSMUSP00000102808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000107190] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: R1147Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: R1147Q

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107190
AA Change: R12Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102808
Gene: ENSMUSG00000038070
AA Change: R12Q

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:HisKA 135 191 8e-27 BLAST
low complexity region 192 213 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: R1146Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: R1146Q

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTTCAATTTACTGACATAGTGG -3'
(R):5'- AGGCCCCAGGAAGTTTAGAG -3'

Sequencing Primer
(F):5'- CTGACATAGTGGCATTAATACCAACG -3'
(R):5'- CCCCAGGAAGTTTAGAGGTCGG -3'
Posted On 2020-07-28