Mutagenetix > Incidental Mutation

Incidental Mutation 'R8264:Cntln'

639722

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.293) question?

Stock #

R8264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 85098411 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 12 (R12Q)

Ref Sequence

ENSEMBL: ENSMUSP00000102808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000107190] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

probably damaging
Transcript: ENSMUST00000047023
AA Change: R1147Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: R1147Q

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107190
AA Change: R12Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102808
Gene: ENSMUSG00000038070
AA Change: R12Q

Domain	Start	End	E-Value	Type
low complexity region	71	82	N/A	INTRINSIC
Blast:HisKA	135	191	8e-27	BLAST
low complexity region	192	213	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169371
AA Change: R1146Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: R1146Q

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (51/52)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,782	C911S	probably damaging	Het
Abcc4	T	A	14: 118,594,842	N792I	possibly damaging	Het
Acacb	A	T	5: 114,207,366	H960L	probably benign	Het
Aox1	A	G	1: 58,053,714	T162A	possibly damaging	Het
Cacna1g	T	C	11: 94,473,566	S18G	probably benign	Het
Chfr	T	A	5: 110,152,434	I348N	possibly damaging	Het
Cyp2c40	A	G	19: 39,807,527	S136P	possibly damaging	Het
Dnah14	T	A	1: 181,744,792	M2896K	probably damaging	Het
Elp6	A	G	9: 110,319,687	T215A	probably damaging	Het
Esyt2	A	C	12: 116,365,920	Q699H	probably benign	Het
Fam179b	A	G	12: 64,995,556	I1130V	probably benign	Het
Fbxo25	A	G	8: 13,929,393	T204A	possibly damaging	Het
Fhdc1	A	G	3: 84,455,032	S294P	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Galnt10	A	G	11: 57,782,206	I463V	probably benign	Het
Glce	A	G	9: 62,060,430	F480L	probably benign	Het
H2-Aa	A	G	17: 34,287,735	V11A	probably benign	Het
Hsd17b4	A	G	18: 50,146,526	T191A	possibly damaging	Het
Itpr3	G	T	17: 27,104,112		silent	Het
Izumo4	G	T	10: 80,702,738	G8V		Het
Klk1b5	T	A	7: 44,220,030	L178H	probably damaging	Het
Lama2	T	C	10: 27,467,222	N85D	probably benign	Het
Liph	A	C	16: 21,983,971	I116R	possibly damaging	Het
Lpar5	T	A	6: 125,081,502	V62D	probably damaging	Het
Map3k19	T	A	1: 127,823,791	I303F		Het
Myo10	G	A	15: 25,800,109	V1424M	probably damaging	Het
Myof	T	G	19: 37,921,433	Q1528P	probably damaging	Het
Ncapd3	T	C	9: 27,094,742		probably benign	Het
Nup214	T	A	2: 31,994,726	Y500N	possibly damaging	Het
Olfr1040	T	C	2: 86,146,194	D180G	probably damaging	Het
Papd4	C	T	13: 93,175,569	G208S	probably damaging	Het
Pappa2	T	C	1: 158,854,973	Y835C	probably damaging	Het
Pcdh18	T	C	3: 49,756,581	E95G	probably damaging	Het
Phf3	A	T	1: 30,831,057	N303K	possibly damaging	Het
Pnn	C	T	12: 59,072,577	H649Y	unknown	Het
Rab11fip1	G	A	8: 27,152,480	Q764*	probably null	Het
Ralgapa2	A	T	2: 146,333,450	M1762K	possibly damaging	Het
Rif1	G	A	2: 52,090,278	A496T	noncoding transcript	Het
Rnase13	A	T	14: 51,922,457	V75D	probably damaging	Het
Sema3c	G	A	5: 17,676,539		probably benign	Het
Sema4c	C	G	1: 36,552,885	G266R	probably damaging	Het
Slfn5	A	T	11: 82,956,550	D87V	probably damaging	Het
Smpd3	T	C	8: 106,264,658	Y421C	probably damaging	Het
Snrnp40	T	C	4: 130,378,074	V188A	probably benign	Het
Srms	A	G	2: 181,212,550	Y75H	probably benign	Het
Tex15	T	C	8: 33,582,362	S2646P	probably benign	Het
Tmem8c	A	G	2: 27,067,856		probably benign	Het
Ttf1	A	G	2: 29,064,677	K18E	possibly damaging	Het
Unc5b	G	T	10: 60,768,334	T827K	probably benign	Het
Zfhx2	T	A	14: 55,065,512	T1672S	possibly damaging	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9353:Cntln	UTSW	4	84884360	unclassified	probably benign
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9382:Cntln	UTSW	4	85050081	missense	probably benign	0.13
R9471:Cntln	UTSW	4	85049782	missense	possibly damaging	0.62
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCAGTTCAATTTACTGACATAGTGG -3'
(R):5'- AGGCCCCAGGAAGTTTAGAG -3'

Sequencing Primer
(F):5'- CTGACATAGTGGCATTAATACCAACG -3'
(R):5'- CCCCAGGAAGTTTAGAGGTCGG -3'

Posted On

2020-07-28