Mutagenetix > Incidental Mutation

Incidental Mutation 'R8264:Chfr'

639724

Institutional Source

Beutler Lab

Gene Symbol

Chfr

Ensembl Gene

ENSMUSG00000014668

Gene Name

checkpoint with forkhead and ring finger domains

Synonyms

RNF116, 5730484M20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.285) question?

Stock #

R8264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110135842-110171972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110152434 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 348 (I348N)

Ref Sequence

ENSEMBL: ENSMUSP00000108138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]

AlphaFold

Q810L3

Predicted Effect

probably damaging
Transcript: ENSMUST00000014812
AA Change: I348N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: I348N

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112519
AA Change: I348N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: I348N

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	513	3.63e0	SMART
Blast:VWA	594	656	3e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000198066

Predicted Effect

probably damaging
Transcript: ENSMUST00000198633
AA Change: I276N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: I276N

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199557

SMART Domains

Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	44	4e-5	SMART
PDB:1LGQ\|B	16	44	1e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199672

Meta Mutation Damage Score

0.7066

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,782	C911S	probably damaging	Het
Abcc4	T	A	14: 118,594,842	N792I	possibly damaging	Het
Acacb	A	T	5: 114,207,366	H960L	probably benign	Het
Aox1	A	G	1: 58,053,714	T162A	possibly damaging	Het
Cacna1g	T	C	11: 94,473,566	S18G	probably benign	Het
Cntln	G	A	4: 85,098,411	R12Q	probably damaging	Het
Cyp2c40	A	G	19: 39,807,527	S136P	possibly damaging	Het
Dnah14	T	A	1: 181,744,792	M2896K	probably damaging	Het
Elp6	A	G	9: 110,319,687	T215A	probably damaging	Het
Esyt2	A	C	12: 116,365,920	Q699H	probably benign	Het
Fbxo25	A	G	8: 13,929,393	T204A	possibly damaging	Het
Fhdc1	A	G	3: 84,455,032	S294P	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Galnt10	A	G	11: 57,782,206	I463V	probably benign	Het
Glce	A	G	9: 62,060,430	F480L	probably benign	Het
H2-Aa	A	G	17: 34,287,735	V11A	probably benign	Het
Hsd17b4	A	G	18: 50,146,526	T191A	possibly damaging	Het
Itpr3	G	T	17: 27,104,112		silent	Het
Izumo4	G	T	10: 80,702,738	G8V		Het
Klk1b5	T	A	7: 44,220,030	L178H	probably damaging	Het
Lama2	T	C	10: 27,467,222	N85D	probably benign	Het
Liph	A	C	16: 21,983,971	I116R	possibly damaging	Het
Lpar5	T	A	6: 125,081,502	V62D	probably damaging	Het
Map3k19	T	A	1: 127,823,791	I303F		Het
Mymk	A	G	2: 27,067,856		probably benign	Het
Myo10	G	A	15: 25,800,109	V1424M	probably damaging	Het
Myof	T	G	19: 37,921,433	Q1528P	probably damaging	Het
Ncapd3	T	C	9: 27,094,742		probably benign	Het
Nup214	T	A	2: 31,994,726	Y500N	possibly damaging	Het
Olfr1040	T	C	2: 86,146,194	D180G	probably damaging	Het
Papd4	C	T	13: 93,175,569	G208S	probably damaging	Het
Pappa2	T	C	1: 158,854,973	Y835C	probably damaging	Het
Pcdh18	T	C	3: 49,756,581	E95G	probably damaging	Het
Phf3	A	T	1: 30,831,057	N303K	possibly damaging	Het
Pnn	C	T	12: 59,072,577	H649Y	unknown	Het
Rab11fip1	G	A	8: 27,152,480	Q764*	probably null	Het
Ralgapa2	A	T	2: 146,333,450	M1762K	possibly damaging	Het
Rif1	G	A	2: 52,090,278	A496T	noncoding transcript	Het
Rnase13	A	T	14: 51,922,457	V75D	probably damaging	Het
Sema3c	G	A	5: 17,676,539		probably benign	Het
Sema4c	C	G	1: 36,552,885	G266R	probably damaging	Het
Slfn5	A	T	11: 82,956,550	D87V	probably damaging	Het
Smpd3	T	C	8: 106,264,658	Y421C	probably damaging	Het
Snrnp40	T	C	4: 130,378,074	V188A	probably benign	Het
Srms	A	G	2: 181,212,550	Y75H	probably benign	Het
Tex15	T	C	8: 33,582,362	S2646P	probably benign	Het
Togaram1	A	G	12: 64,995,556	I1130V	probably benign	Het
Ttf1	A	G	2: 29,064,677	K18E	possibly damaging	Het
Unc5b	G	T	10: 60,768,334	T827K	probably benign	Het
Zfhx2	T	A	14: 55,065,512	T1672S	possibly damaging	Het

Other mutations in Chfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Chfr	APN	5	110143573	missense	possibly damaging	0.94
IGL01479:Chfr	APN	5	110144993	unclassified	probably benign
IGL02543:Chfr	APN	5	110143547	splice site	probably null
IGL02657:Chfr	APN	5	110154839	missense	probably damaging	1.00
IGL03057:Chfr	APN	5	110143609	missense	probably benign	0.14
PIT4445001:Chfr	UTSW	5	110151677	missense	possibly damaging	0.88
R0938:Chfr	UTSW	5	110164058	missense	probably damaging	1.00
R1346:Chfr	UTSW	5	110140447	missense	probably damaging	1.00
R1561:Chfr	UTSW	5	110158808	missense	probably benign	0.05
R1602:Chfr	UTSW	5	110151665	missense	probably benign	0.26
R1658:Chfr	UTSW	5	110153169	missense	probably damaging	1.00
R2134:Chfr	UTSW	5	110144761	splice site	probably null
R2234:Chfr	UTSW	5	110170863	missense	probably damaging	1.00
R4371:Chfr	UTSW	5	110136168	missense	probably damaging	0.99
R4420:Chfr	UTSW	5	110170880	nonsense	probably null
R4666:Chfr	UTSW	5	110144867	nonsense	probably null
R4742:Chfr	UTSW	5	110143598	missense	probably benign	0.04
R4809:Chfr	UTSW	5	110158834	missense	probably damaging	1.00
R5490:Chfr	UTSW	5	110153129	missense	possibly damaging	0.88
R5581:Chfr	UTSW	5	110153282	critical splice donor site	probably null
R5820:Chfr	UTSW	5	110162739	missense	possibly damaging	0.94
R6012:Chfr	UTSW	5	110144651	critical splice donor site	probably null
R7128:Chfr	UTSW	5	110143636	missense	probably benign	0.33
R7166:Chfr	UTSW	5	110158805	missense	probably benign
R7278:Chfr	UTSW	5	110140360	missense	probably benign	0.23
R7393:Chfr	UTSW	5	110152358	missense	probably damaging	0.98
R7422:Chfr	UTSW	5	110162705	splice site	probably null
R7499:Chfr	UTSW	5	110151683	missense	probably benign	0.40
R8224:Chfr	UTSW	5	110160243	critical splice donor site	probably null
R8325:Chfr	UTSW	5	110162763	nonsense	probably null
R8333:Chfr	UTSW	5	110154937	missense	probably benign	0.05
R8823:Chfr	UTSW	5	110152392	missense	probably damaging	0.96
R9024:Chfr	UTSW	5	110158832	missense	probably benign	0.26
R9419:Chfr	UTSW	5	110169190	missense	probably damaging	1.00
X0013:Chfr	UTSW	5	110151579	missense	probably benign	0.19
Z1176:Chfr	UTSW	5	110144895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGTGTCACAGTGGCAGATC -3'
(R):5'- AGCAGTCACTGGCAAAGG -3'

Sequencing Primer
(F):5'- CACAGTGGCAGATCTTTGGAC -3'
(R):5'- GTGTGTGCCTTACATCCAGGAAC -3'

Posted On

2020-07-28