Incidental Mutation 'R8264:Chfr'
ID 639724
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms 5730484M20Rik, RNF116
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110283708-110319838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110300300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 348 (I348N)
Ref Sequence ENSEMBL: ENSMUSP00000108138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]
AlphaFold Q810L3
Predicted Effect probably damaging
Transcript: ENSMUST00000014812
AA Change: I348N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: I348N

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112519
AA Change: I348N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: I348N

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably damaging
Transcript: ENSMUST00000198633
AA Change: I276N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: I276N

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Meta Mutation Damage Score 0.7066 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110,291,439 (GRCm39) missense possibly damaging 0.94
IGL01479:Chfr APN 5 110,292,859 (GRCm39) unclassified probably benign
IGL02543:Chfr APN 5 110,291,413 (GRCm39) splice site probably null
IGL02657:Chfr APN 5 110,302,705 (GRCm39) missense probably damaging 1.00
IGL03057:Chfr APN 5 110,291,475 (GRCm39) missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110,299,543 (GRCm39) missense possibly damaging 0.88
R0938:Chfr UTSW 5 110,311,924 (GRCm39) missense probably damaging 1.00
R1346:Chfr UTSW 5 110,288,313 (GRCm39) missense probably damaging 1.00
R1561:Chfr UTSW 5 110,306,674 (GRCm39) missense probably benign 0.05
R1602:Chfr UTSW 5 110,299,531 (GRCm39) missense probably benign 0.26
R1658:Chfr UTSW 5 110,301,035 (GRCm39) missense probably damaging 1.00
R2134:Chfr UTSW 5 110,292,627 (GRCm39) splice site probably null
R2234:Chfr UTSW 5 110,318,729 (GRCm39) missense probably damaging 1.00
R4371:Chfr UTSW 5 110,284,034 (GRCm39) missense probably damaging 0.99
R4420:Chfr UTSW 5 110,318,746 (GRCm39) nonsense probably null
R4666:Chfr UTSW 5 110,292,733 (GRCm39) nonsense probably null
R4742:Chfr UTSW 5 110,291,464 (GRCm39) missense probably benign 0.04
R4809:Chfr UTSW 5 110,306,700 (GRCm39) missense probably damaging 1.00
R5490:Chfr UTSW 5 110,300,995 (GRCm39) missense possibly damaging 0.88
R5581:Chfr UTSW 5 110,301,148 (GRCm39) critical splice donor site probably null
R5820:Chfr UTSW 5 110,310,605 (GRCm39) missense possibly damaging 0.94
R6012:Chfr UTSW 5 110,292,517 (GRCm39) critical splice donor site probably null
R7128:Chfr UTSW 5 110,291,502 (GRCm39) missense probably benign 0.33
R7166:Chfr UTSW 5 110,306,671 (GRCm39) missense probably benign
R7278:Chfr UTSW 5 110,288,226 (GRCm39) missense probably benign 0.23
R7393:Chfr UTSW 5 110,300,224 (GRCm39) missense probably damaging 0.98
R7422:Chfr UTSW 5 110,310,571 (GRCm39) splice site probably null
R7499:Chfr UTSW 5 110,299,549 (GRCm39) missense probably benign 0.40
R8224:Chfr UTSW 5 110,308,109 (GRCm39) critical splice donor site probably null
R8325:Chfr UTSW 5 110,310,629 (GRCm39) nonsense probably null
R8333:Chfr UTSW 5 110,302,803 (GRCm39) missense probably benign 0.05
R8823:Chfr UTSW 5 110,300,258 (GRCm39) missense probably damaging 0.96
R9024:Chfr UTSW 5 110,306,698 (GRCm39) missense probably benign 0.26
R9419:Chfr UTSW 5 110,317,056 (GRCm39) missense probably damaging 1.00
X0013:Chfr UTSW 5 110,299,445 (GRCm39) missense probably benign 0.19
Z1176:Chfr UTSW 5 110,292,761 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTGTCACAGTGGCAGATC -3'
(R):5'- AGCAGTCACTGGCAAAGG -3'

Sequencing Primer
(F):5'- CACAGTGGCAGATCTTTGGAC -3'
(R):5'- GTGTGTGCCTTACATCCAGGAAC -3'
Posted On 2020-07-28