Incidental Mutation 'R8264:Chfr'
ID 639724
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110152434 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 348 (I348N)
Ref Sequence ENSEMBL: ENSMUSP00000108138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]
AlphaFold Q810L3
Predicted Effect probably damaging
Transcript: ENSMUST00000014812
AA Change: I348N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: I348N

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112519
AA Change: I348N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: I348N

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably damaging
Transcript: ENSMUST00000198633
AA Change: I276N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: I276N

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Meta Mutation Damage Score 0.7066 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,782 C911S probably damaging Het
Abcc4 T A 14: 118,594,842 N792I possibly damaging Het
Acacb A T 5: 114,207,366 H960L probably benign Het
Aox1 A G 1: 58,053,714 T162A possibly damaging Het
Cacna1g T C 11: 94,473,566 S18G probably benign Het
Cntln G A 4: 85,098,411 R12Q probably damaging Het
Cyp2c40 A G 19: 39,807,527 S136P possibly damaging Het
Dnah14 T A 1: 181,744,792 M2896K probably damaging Het
Elp6 A G 9: 110,319,687 T215A probably damaging Het
Esyt2 A C 12: 116,365,920 Q699H probably benign Het
Fam179b A G 12: 64,995,556 I1130V probably benign Het
Fbxo25 A G 8: 13,929,393 T204A possibly damaging Het
Fhdc1 A G 3: 84,455,032 S294P probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Galnt10 A G 11: 57,782,206 I463V probably benign Het
Glce A G 9: 62,060,430 F480L probably benign Het
H2-Aa A G 17: 34,287,735 V11A probably benign Het
Hsd17b4 A G 18: 50,146,526 T191A possibly damaging Het
Itpr3 G T 17: 27,104,112 silent Het
Izumo4 G T 10: 80,702,738 G8V Het
Klk1b5 T A 7: 44,220,030 L178H probably damaging Het
Lama2 T C 10: 27,467,222 N85D probably benign Het
Liph A C 16: 21,983,971 I116R possibly damaging Het
Lpar5 T A 6: 125,081,502 V62D probably damaging Het
Map3k19 T A 1: 127,823,791 I303F Het
Myo10 G A 15: 25,800,109 V1424M probably damaging Het
Myof T G 19: 37,921,433 Q1528P probably damaging Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Nup214 T A 2: 31,994,726 Y500N possibly damaging Het
Olfr1040 T C 2: 86,146,194 D180G probably damaging Het
Papd4 C T 13: 93,175,569 G208S probably damaging Het
Pappa2 T C 1: 158,854,973 Y835C probably damaging Het
Pcdh18 T C 3: 49,756,581 E95G probably damaging Het
Phf3 A T 1: 30,831,057 N303K possibly damaging Het
Pnn C T 12: 59,072,577 H649Y unknown Het
Rab11fip1 G A 8: 27,152,480 Q764* probably null Het
Ralgapa2 A T 2: 146,333,450 M1762K possibly damaging Het
Rif1 G A 2: 52,090,278 A496T noncoding transcript Het
Rnase13 A T 14: 51,922,457 V75D probably damaging Het
Sema3c G A 5: 17,676,539 probably benign Het
Sema4c C G 1: 36,552,885 G266R probably damaging Het
Slfn5 A T 11: 82,956,550 D87V probably damaging Het
Smpd3 T C 8: 106,264,658 Y421C probably damaging Het
Snrnp40 T C 4: 130,378,074 V188A probably benign Het
Srms A G 2: 181,212,550 Y75H probably benign Het
Tex15 T C 8: 33,582,362 S2646P probably benign Het
Tmem8c A G 2: 27,067,856 probably benign Het
Ttf1 A G 2: 29,064,677 K18E possibly damaging Het
Unc5b G T 10: 60,768,334 T827K probably benign Het
Zfhx2 T A 14: 55,065,512 T1672S possibly damaging Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9024:Chfr UTSW 5 110158832 missense probably benign 0.26
R9419:Chfr UTSW 5 110169190 missense probably damaging 1.00
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTGTCACAGTGGCAGATC -3'
(R):5'- AGCAGTCACTGGCAAAGG -3'

Sequencing Primer
(F):5'- CACAGTGGCAGATCTTTGGAC -3'
(R):5'- GTGTGTGCCTTACATCCAGGAAC -3'
Posted On 2020-07-28