Incidental Mutation 'R8264:Acacb'
ID 639725
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114345427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 960 (H960L)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably benign
Transcript: ENSMUST00000031583
AA Change: H960L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: H960L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102582
AA Change: H960L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: H960L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Meta Mutation Damage Score 0.1377 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGCTGTCACTGTGATGCAACC -3'
(R):5'- GAGCAAACAAGTGCCATGGC -3'

Sequencing Primer
(F):5'- TGTGATGCAACCCCAGCTC -3'
(R):5'- ATGGCTGCCATGTTACATCATCG -3'
Posted On 2020-07-28