Incidental Mutation 'R8264:Lpar5'
ID 639726
Institutional Source Beutler Lab
Gene Symbol Lpar5
Ensembl Gene ENSMUSG00000067714
Gene Name lysophosphatidic acid receptor 5
Synonyms LPA5, LOC381810, Gpr92, GPR93
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 125067920-125082472 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125081502 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 62 (V62D)
Ref Sequence ENSEMBL: ENSMUSP00000085630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088292] [ENSMUST00000140346] [ENSMUST00000171989]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000088292
AA Change: V62D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085630
Gene: ENSMUSG00000067714
AA Change: V62D

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 7.4e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140346
AA Change: V62D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119904
Gene: ENSMUSG00000067714
AA Change: V62D

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 164 1.5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171989
AA Change: V62D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132511
Gene: ENSMUSG00000067714
AA Change: V62D

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 1.1e-48 PFAM
Meta Mutation Damage Score 0.7091 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin class of G protein-coupled transmembrane receptors. This protein transmits extracellular signals from lysophosphatidic acid to cells through heterotrimeric G proteins and mediates numerous cellular processes. Many G protein receptors serve as targets for pharmaceutical drugs. Transcript variants of this gene have been described.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to neuropathic pain and myelin sheath alterations. Mice homozygous for a different targeted allele exhibit decreased nociception sensitivity, decreased anxiety-related response and enhanced coordination and spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,782 C911S probably damaging Het
Abcc4 T A 14: 118,594,842 N792I possibly damaging Het
Acacb A T 5: 114,207,366 H960L probably benign Het
Aox1 A G 1: 58,053,714 T162A possibly damaging Het
Cacna1g T C 11: 94,473,566 S18G probably benign Het
Chfr T A 5: 110,152,434 I348N possibly damaging Het
Cntln G A 4: 85,098,411 R12Q probably damaging Het
Cyp2c40 A G 19: 39,807,527 S136P possibly damaging Het
Dnah14 T A 1: 181,744,792 M2896K probably damaging Het
Elp6 A G 9: 110,319,687 T215A probably damaging Het
Esyt2 A C 12: 116,365,920 Q699H probably benign Het
Fam179b A G 12: 64,995,556 I1130V probably benign Het
Fbxo25 A G 8: 13,929,393 T204A possibly damaging Het
Fhdc1 A G 3: 84,455,032 S294P probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Galnt10 A G 11: 57,782,206 I463V probably benign Het
Glce A G 9: 62,060,430 F480L probably benign Het
H2-Aa A G 17: 34,287,735 V11A probably benign Het
Hsd17b4 A G 18: 50,146,526 T191A possibly damaging Het
Itpr3 G T 17: 27,104,112 silent Het
Izumo4 G T 10: 80,702,738 G8V Het
Klk1b5 T A 7: 44,220,030 L178H probably damaging Het
Lama2 T C 10: 27,467,222 N85D probably benign Het
Liph A C 16: 21,983,971 I116R possibly damaging Het
Map3k19 T A 1: 127,823,791 I303F Het
Myo10 G A 15: 25,800,109 V1424M probably damaging Het
Myof T G 19: 37,921,433 Q1528P probably damaging Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Nup214 T A 2: 31,994,726 Y500N possibly damaging Het
Olfr1040 T C 2: 86,146,194 D180G probably damaging Het
Papd4 C T 13: 93,175,569 G208S probably damaging Het
Pappa2 T C 1: 158,854,973 Y835C probably damaging Het
Pcdh18 T C 3: 49,756,581 E95G probably damaging Het
Phf3 A T 1: 30,831,057 N303K possibly damaging Het
Pnn C T 12: 59,072,577 H649Y unknown Het
Rab11fip1 G A 8: 27,152,480 Q764* probably null Het
Ralgapa2 A T 2: 146,333,450 M1762K possibly damaging Het
Rif1 G A 2: 52,090,278 A496T noncoding transcript Het
Rnase13 A T 14: 51,922,457 V75D probably damaging Het
Sema3c G A 5: 17,676,539 probably benign Het
Sema4c C G 1: 36,552,885 G266R probably damaging Het
Slfn5 A T 11: 82,956,550 D87V probably damaging Het
Smpd3 T C 8: 106,264,658 Y421C probably damaging Het
Snrnp40 T C 4: 130,378,074 V188A probably benign Het
Srms A G 2: 181,212,550 Y75H probably benign Het
Tex15 T C 8: 33,582,362 S2646P probably benign Het
Tmem8c A G 2: 27,067,856 probably benign Het
Ttf1 A G 2: 29,064,677 K18E possibly damaging Het
Unc5b G T 10: 60,768,334 T827K probably benign Het
Zfhx2 T A 14: 55,065,512 T1672S possibly damaging Het
Other mutations in Lpar5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Lpar5 APN 6 125082006 missense possibly damaging 0.94
IGL01830:Lpar5 APN 6 125081822 missense probably benign 0.01
IGL01975:Lpar5 APN 6 125081787 missense probably damaging 0.99
IGL02021:Lpar5 APN 6 125081992 nonsense probably null
IGL02718:Lpar5 APN 6 125082244 missense probably damaging 1.00
IGL03027:Lpar5 APN 6 125082240 missense probably damaging 1.00
IGL03300:Lpar5 APN 6 125082240 missense probably damaging 1.00
F5770:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
R0633:Lpar5 UTSW 6 125081991 missense probably benign 0.25
R1639:Lpar5 UTSW 6 125081601 missense probably damaging 1.00
R1822:Lpar5 UTSW 6 125081415 missense possibly damaging 0.76
R2227:Lpar5 UTSW 6 125081135 critical splice acceptor site probably null
R4019:Lpar5 UTSW 6 125081675 missense probably damaging 1.00
R4288:Lpar5 UTSW 6 125081864 missense probably benign 0.00
R4705:Lpar5 UTSW 6 125082207 missense possibly damaging 0.64
R4787:Lpar5 UTSW 6 125082498 splice site probably null
R5027:Lpar5 UTSW 6 125082147 missense possibly damaging 0.69
R6114:Lpar5 UTSW 6 125081676 missense probably damaging 1.00
R7197:Lpar5 UTSW 6 125082384 missense probably benign 0.00
R7779:Lpar5 UTSW 6 125082244 missense probably damaging 1.00
R8193:Lpar5 UTSW 6 125081339 missense probably benign
R9460:Lpar5 UTSW 6 125081271 start gained probably benign
R9628:Lpar5 UTSW 6 125081985 missense probably damaging 0.96
V7580:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
V7581:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
V7582:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
Z1176:Lpar5 UTSW 6 125081379 missense possibly damaging 0.92
Z1176:Lpar5 UTSW 6 125082072 missense probably damaging 1.00
Z1177:Lpar5 UTSW 6 125082018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGTGAAAGTCATGCTCTG -3'
(R):5'- GCTGCCGTACATGTTCATCTG -3'

Sequencing Primer
(F):5'- ACGATGCCTCAGACTAATTTCTC -3'
(R):5'- ATCTGGAAGATGGCGCCC -3'
Posted On 2020-07-28