Incidental Mutation 'R8264:Klk1b5'
ID 639727
Institutional Source Beutler Lab
Gene Symbol Klk1b5
Ensembl Gene ENSMUSG00000066512
Gene Name kallikrein 1-related peptidase b5
Synonyms mGK-5, Klk5
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 43865898-43870127 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43869454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 178 (L178H)
Ref Sequence ENSEMBL: ENSMUSP00000073964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074359]
AlphaFold P15945
Predicted Effect probably damaging
Transcript: ENSMUST00000074359
AA Change: L178H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073964
Gene: ENSMUSG00000066512
AA Change: L178H

DomainStartEndE-ValueType
Tryp_SPc 24 253 1.49e-100 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Klk1b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Klk1b5 APN 7 43,865,928 (GRCm39) missense probably benign 0.00
IGL02379:Klk1b5 APN 7 43,500,246 (GRCm39) missense probably damaging 0.99
R0515:Klk1b5 UTSW 7 43,867,957 (GRCm39) missense probably damaging 1.00
R0706:Klk1b5 UTSW 7 43,867,938 (GRCm39) missense probably damaging 1.00
R1209:Klk1b5 UTSW 7 43,496,422 (GRCm39) missense probably damaging 0.99
R1227:Klk1b5 UTSW 7 43,496,670 (GRCm39) splice site probably null
R1261:Klk1b5 UTSW 7 43,494,714 (GRCm39) missense probably damaging 0.98
R1689:Klk1b5 UTSW 7 43,869,969 (GRCm39) missense probably damaging 0.98
R1845:Klk1b5 UTSW 7 43,869,549 (GRCm39) missense probably benign
R2153:Klk1b5 UTSW 7 43,869,322 (GRCm39) critical splice donor site probably null
R3700:Klk1b5 UTSW 7 43,500,251 (GRCm39) missense probably damaging 1.00
R4612:Klk1b5 UTSW 7 43,494,696 (GRCm39) missense possibly damaging 0.66
R4825:Klk1b5 UTSW 7 43,494,814 (GRCm39) missense probably damaging 1.00
R7456:Klk1b5 UTSW 7 43,500,255 (GRCm39) missense probably benign 0.02
R7556:Klk1b5 UTSW 7 43,496,649 (GRCm39) missense probably damaging 0.99
R8402:Klk1b5 UTSW 7 43,867,962 (GRCm39) missense probably benign 0.01
R8475:Klk1b5 UTSW 7 43,500,204 (GRCm39) missense possibly damaging 0.64
R8711:Klk1b5 UTSW 7 43,867,996 (GRCm39) missense probably benign 0.02
R8813:Klk1b5 UTSW 7 43,496,549 (GRCm39) missense probably benign 0.08
R8886:Klk1b5 UTSW 7 43,869,192 (GRCm39) missense probably damaging 1.00
R9101:Klk1b5 UTSW 7 43,500,205 (GRCm39) missense probably benign 0.44
RF024:Klk1b5 UTSW 7 43,491,798 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATGTTGTGAAGCCCATCGACC -3'
(R):5'- CCTAGTCAGGGTGTGGAAGTAG -3'

Sequencing Primer
(F):5'- ATCGACCTGCCCACTGAG -3'
(R):5'- GGAACCAAGGACCTCAATTCTCTTTC -3'
Posted On 2020-07-28