Incidental Mutation 'R8264:Fbxo25'
ID639728
Institutional Source Beutler Lab
Gene Symbol Fbxo25
Ensembl Gene ENSMUSG00000038365
Gene NameF-box protein 25
Synonyms9130015I06Rik, Fbx25
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R8264 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13907803-13940522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13929393 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 204 (T204A)
Ref Sequence ENSEMBL: ENSMUSP00000039544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043520] [ENSMUST00000209913]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043520
AA Change: T204A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039544
Gene: ENSMUSG00000038365
AA Change: T204A

DomainStartEndE-ValueType
low complexity region 209 222 N/A INTRINSIC
Blast:FBOX 230 271 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209913
AA Change: T204A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,782 C911S probably damaging Het
Abcc4 T A 14: 118,594,842 N792I possibly damaging Het
Acacb A T 5: 114,207,366 H960L probably benign Het
Aox1 A G 1: 58,053,714 T162A possibly damaging Het
Cacna1g T C 11: 94,473,566 S18G probably benign Het
Chfr T A 5: 110,152,434 I348N possibly damaging Het
Cntln G A 4: 85,098,411 R12Q probably damaging Het
Cyp2c40 A G 19: 39,807,527 S136P possibly damaging Het
Dnah14 T A 1: 181,744,792 M2896K probably damaging Het
Elp6 A G 9: 110,319,687 T215A probably damaging Het
Esyt2 A C 12: 116,365,920 Q699H probably benign Het
Fam179b A G 12: 64,995,556 I1130V probably benign Het
Fhdc1 A G 3: 84,455,032 S294P probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Galnt10 A G 11: 57,782,206 I463V probably benign Het
Glce A G 9: 62,060,430 F480L probably benign Het
H2-Aa A G 17: 34,287,735 V11A probably benign Het
Hsd17b4 A G 18: 50,146,526 T191A possibly damaging Het
Itpr3 G T 17: 27,104,112 silent Het
Izumo4 G T 10: 80,702,738 G8V Het
Klk1b5 T A 7: 44,220,030 L178H probably damaging Het
Lama2 T C 10: 27,467,222 N85D probably benign Het
Liph A C 16: 21,983,971 I116R possibly damaging Het
Lpar5 T A 6: 125,081,502 V62D probably damaging Het
Map3k19 T A 1: 127,823,791 I303F Het
Myo10 G A 15: 25,800,109 V1424M probably damaging Het
Myof T G 19: 37,921,433 Q1528P probably damaging Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Nup214 T A 2: 31,994,726 Y500N possibly damaging Het
Olfr1040 T C 2: 86,146,194 D180G probably damaging Het
Papd4 C T 13: 93,175,569 G208S probably damaging Het
Pappa2 T C 1: 158,854,973 Y835C probably damaging Het
Pcdh18 T C 3: 49,756,581 E95G probably damaging Het
Phf3 A T 1: 30,831,057 N303K possibly damaging Het
Pnn C T 12: 59,072,577 H649Y unknown Het
Rab11fip1 G A 8: 27,152,480 Q764* probably null Het
Ralgapa2 A T 2: 146,333,450 M1762K possibly damaging Het
Rif1 G A 2: 52,090,278 A496T noncoding transcript Het
Rnase13 A T 14: 51,922,457 V75D probably damaging Het
Sema3c G A 5: 17,676,539 probably benign Het
Sema4c C G 1: 36,552,885 G266R probably damaging Het
Slfn5 A T 11: 82,956,550 D87V probably damaging Het
Smpd3 T C 8: 106,264,658 Y421C probably damaging Het
Snrnp40 T C 4: 130,378,074 V188A probably benign Het
Srms A G 2: 181,212,550 Y75H probably benign Het
Tex15 T C 8: 33,582,362 S2646P probably benign Het
Tmem8c A G 2: 27,067,856 probably benign Het
Ttf1 A G 2: 29,064,677 K18E possibly damaging Het
Unc5b G T 10: 60,768,334 T827K probably benign Het
Zfhx2 T A 14: 55,065,512 T1672S possibly damaging Het
Other mutations in Fbxo25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Fbxo25 APN 8 13923922 unclassified probably benign
IGL03087:Fbxo25 APN 8 13924019 critical splice donor site probably null
IGL03112:Fbxo25 APN 8 13921034 missense probably benign 0.18
IGL03403:Fbxo25 APN 8 13929423 missense probably benign 0.00
R0720:Fbxo25 UTSW 8 13935222 missense probably damaging 1.00
R0755:Fbxo25 UTSW 8 13935219 missense probably benign 0.00
R1865:Fbxo25 UTSW 8 13935248 missense probably damaging 1.00
R2043:Fbxo25 UTSW 8 13921905 missense probably damaging 0.99
R4213:Fbxo25 UTSW 8 13939581 missense probably damaging 1.00
R4248:Fbxo25 UTSW 8 13939617 missense probably damaging 1.00
R5380:Fbxo25 UTSW 8 13921886 missense probably benign 0.10
R7450:Fbxo25 UTSW 8 13931235 missense probably benign 0.09
R8409:Fbxo25 UTSW 8 13914999 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTTAACAGTAGTCCTTGCTTG -3'
(R):5'- GCAAAATCCTGTCTCTGGGG -3'

Sequencing Primer
(F):5'- AACAGTAGTCCTTGCTTGGTTTTG -3'
(R):5'- AGAGAGAGAGAGAGAGAGGAAAGG -3'
Posted On2020-07-28