Incidental Mutation 'R8264:Rab11fip1'
ID 639729
Institutional Source Beutler Lab
Gene Symbol Rab11fip1
Ensembl Gene ENSMUSG00000031488
Gene Name RAB11 family interacting protein 1 (class I)
Synonyms 2010200K21Rik, 4833414G05Rik
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 27628801-27664674 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 27642508 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 764 (Q764*)
Ref Sequence ENSEMBL: ENSMUSP00000058042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033878] [ENSMUST00000054212] [ENSMUST00000209377]
AlphaFold Q9D620
Predicted Effect probably benign
Transcript: ENSMUST00000033878
SMART Domains Protein: ENSMUSP00000033878
Gene: ENSMUSG00000031488

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
Pfam:RBD-FIP 588 635 6.1e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000054212
AA Change: Q764*
SMART Domains Protein: ENSMUSP00000058042
Gene: ENSMUSG00000031488
AA Change: Q764*

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
low complexity region 582 600 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 745 757 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
low complexity region 976 983 N/A INTRINSIC
low complexity region 992 999 N/A INTRINSIC
Pfam:RBD-FIP 1109 1156 3.8e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209377
AA Change: Q764*
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the Rab11-family interacting proteins (Rab11-FIPs), which play a role in the Rab-11 mediated recycling of vesicles. The encoded protein may be involved in endocytic sorting, trafficking of proteins including integrin subunits and epidermal growth factor receptor (EGFR), and transport between the recycling endosome and the trans-Golgi network. Alternative splicing results in multiple transcript variants. A pseudogene is described on the X chromosome. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous knockout results in reduced metastatic potential of pancreatic adenocarcinoma (PDAC) tumor cells in KPC (PDAC model) mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Rab11fip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Rab11fip1 APN 8 27,644,804 (GRCm39) missense possibly damaging 0.71
IGL01976:Rab11fip1 APN 8 27,642,825 (GRCm39) missense possibly damaging 0.56
IGL02832:Rab11fip1 APN 8 27,642,840 (GRCm39) missense possibly damaging 0.79
IGL02799:Rab11fip1 UTSW 8 27,642,788 (GRCm39) missense probably benign 0.12
R0046:Rab11fip1 UTSW 8 27,643,149 (GRCm39) missense probably damaging 0.99
R0046:Rab11fip1 UTSW 8 27,643,149 (GRCm39) missense probably damaging 0.99
R0145:Rab11fip1 UTSW 8 27,633,352 (GRCm39) missense probably damaging 1.00
R0243:Rab11fip1 UTSW 8 27,642,253 (GRCm39) missense probably damaging 1.00
R0427:Rab11fip1 UTSW 8 27,644,520 (GRCm39) missense probably damaging 0.99
R1341:Rab11fip1 UTSW 8 27,633,388 (GRCm39) missense probably damaging 0.99
R1487:Rab11fip1 UTSW 8 27,644,240 (GRCm39) missense probably damaging 0.99
R1509:Rab11fip1 UTSW 8 27,643,051 (GRCm39) missense probably damaging 1.00
R1731:Rab11fip1 UTSW 8 27,642,438 (GRCm39) missense probably damaging 0.98
R3832:Rab11fip1 UTSW 8 27,642,774 (GRCm39) missense probably benign
R4157:Rab11fip1 UTSW 8 27,642,175 (GRCm39) missense probably damaging 1.00
R4451:Rab11fip1 UTSW 8 27,644,505 (GRCm39) missense probably damaging 1.00
R4595:Rab11fip1 UTSW 8 27,644,603 (GRCm39) missense probably damaging 0.98
R4620:Rab11fip1 UTSW 8 27,644,243 (GRCm39) missense probably damaging 1.00
R4753:Rab11fip1 UTSW 8 27,642,769 (GRCm39) missense probably benign
R4834:Rab11fip1 UTSW 8 27,643,111 (GRCm39) missense probably damaging 1.00
R4958:Rab11fip1 UTSW 8 27,644,841 (GRCm39) missense probably damaging 0.99
R5102:Rab11fip1 UTSW 8 27,646,402 (GRCm39) missense probably damaging 0.99
R5558:Rab11fip1 UTSW 8 27,642,003 (GRCm39) missense probably damaging 1.00
R5752:Rab11fip1 UTSW 8 27,646,614 (GRCm39) missense probably damaging 0.99
R5859:Rab11fip1 UTSW 8 27,644,748 (GRCm39) missense probably damaging 1.00
R6525:Rab11fip1 UTSW 8 27,646,527 (GRCm39) missense probably benign 0.45
R6527:Rab11fip1 UTSW 8 27,664,420 (GRCm39) missense probably damaging 0.99
R6551:Rab11fip1 UTSW 8 27,646,512 (GRCm39) missense probably damaging 0.96
R6695:Rab11fip1 UTSW 8 27,633,262 (GRCm39) missense probably damaging 1.00
R6730:Rab11fip1 UTSW 8 27,633,257 (GRCm39) missense probably damaging 1.00
R6810:Rab11fip1 UTSW 8 27,642,760 (GRCm39) frame shift probably null
R6925:Rab11fip1 UTSW 8 27,643,000 (GRCm39) missense probably damaging 1.00
R6941:Rab11fip1 UTSW 8 27,646,303 (GRCm39) nonsense probably null
R7481:Rab11fip1 UTSW 8 27,646,609 (GRCm39) missense probably damaging 1.00
R7504:Rab11fip1 UTSW 8 27,642,981 (GRCm39) missense possibly damaging 0.78
R7610:Rab11fip1 UTSW 8 27,642,064 (GRCm39) missense probably benign 0.19
R8360:Rab11fip1 UTSW 8 27,642,374 (GRCm39) nonsense probably null
R8958:Rab11fip1 UTSW 8 27,644,940 (GRCm39) missense possibly damaging 0.91
R9025:Rab11fip1 UTSW 8 27,644,736 (GRCm39) missense probably benign 0.00
R9093:Rab11fip1 UTSW 8 27,633,355 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATCCATCAAAGGCTGGG -3'
(R):5'- GATGGCGGAATGACTACAGC -3'

Sequencing Primer
(F):5'- GTACCTCTTGCTGGGCTG -3'
(R):5'- TCTTCTAGAGGACGAGGCCTC -3'
Posted On 2020-07-28