Mutagenetix > Incidental Mutation

Incidental Mutation 'R8264:Rab11fip1'

639729

Institutional Source

Beutler Lab

Gene Symbol

Rab11fip1

Ensembl Gene

ENSMUSG00000031488

Gene Name

RAB11 family interacting protein 1 (class I)

Synonyms

4833414G05Rik, 2010200K21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R8264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27138773-27174646 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 27152480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 764 (Q764*)

Ref Sequence

ENSEMBL: ENSMUSP00000058042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033878] [ENSMUST00000054212] [ENSMUST00000209377]

AlphaFold

Q9D620

Predicted Effect

probably benign
Transcript: ENSMUST00000033878

SMART Domains

Protein: ENSMUSP00000033878
Gene: ENSMUSG00000031488

Domain	Start	End	E-Value	Type
C2	19	125	1.57e-13	SMART
low complexity region	173	185	N/A	INTRINSIC
low complexity region	201	227	N/A	INTRINSIC
low complexity region	260	273	N/A	INTRINSIC
low complexity region	373	396	N/A	INTRINSIC
low complexity region	423	438	N/A	INTRINSIC
Pfam:RBD-FIP	588	635	6.1e-25	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000054212
AA Change: Q764*

SMART Domains

Protein: ENSMUSP00000058042
Gene: ENSMUSG00000031488
AA Change: Q764*

Domain	Start	End	E-Value	Type
C2	19	125	1.57e-13	SMART
low complexity region	173	185	N/A	INTRINSIC
low complexity region	201	227	N/A	INTRINSIC
low complexity region	260	273	N/A	INTRINSIC
low complexity region	373	396	N/A	INTRINSIC
low complexity region	423	438	N/A	INTRINSIC
low complexity region	582	600	N/A	INTRINSIC
low complexity region	695	708	N/A	INTRINSIC
low complexity region	745	757	N/A	INTRINSIC
low complexity region	882	893	N/A	INTRINSIC
low complexity region	976	983	N/A	INTRINSIC
low complexity region	992	999	N/A	INTRINSIC
Pfam:RBD-FIP	1109	1156	3.8e-25	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000209377
AA Change: Q764*

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the Rab11-family interacting proteins (Rab11-FIPs), which play a role in the Rab-11 mediated recycling of vesicles. The encoded protein may be involved in endocytic sorting, trafficking of proteins including integrin subunits and epidermal growth factor receptor (EGFR), and transport between the recycling endosome and the trans-Golgi network. Alternative splicing results in multiple transcript variants. A pseudogene is described on the X chromosome. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous knockout results in reduced metastatic potential of pancreatic adenocarcinoma (PDAC) tumor cells in KPC (PDAC model) mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,782	C911S	probably damaging	Het
Abcc4	T	A	14: 118,594,842	N792I	possibly damaging	Het
Acacb	A	T	5: 114,207,366	H960L	probably benign	Het
Aox1	A	G	1: 58,053,714	T162A	possibly damaging	Het
Cacna1g	T	C	11: 94,473,566	S18G	probably benign	Het
Chfr	T	A	5: 110,152,434	I348N	possibly damaging	Het
Cntln	G	A	4: 85,098,411	R12Q	probably damaging	Het
Cyp2c40	A	G	19: 39,807,527	S136P	possibly damaging	Het
Dnah14	T	A	1: 181,744,792	M2896K	probably damaging	Het
Elp6	A	G	9: 110,319,687	T215A	probably damaging	Het
Esyt2	A	C	12: 116,365,920	Q699H	probably benign	Het
Fbxo25	A	G	8: 13,929,393	T204A	possibly damaging	Het
Fhdc1	A	G	3: 84,455,032	S294P	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Galnt10	A	G	11: 57,782,206	I463V	probably benign	Het
Glce	A	G	9: 62,060,430	F480L	probably benign	Het
H2-Aa	A	G	17: 34,287,735	V11A	probably benign	Het
Hsd17b4	A	G	18: 50,146,526	T191A	possibly damaging	Het
Itpr3	G	T	17: 27,104,112		silent	Het
Izumo4	G	T	10: 80,702,738	G8V		Het
Klk1b5	T	A	7: 44,220,030	L178H	probably damaging	Het
Lama2	T	C	10: 27,467,222	N85D	probably benign	Het
Liph	A	C	16: 21,983,971	I116R	possibly damaging	Het
Lpar5	T	A	6: 125,081,502	V62D	probably damaging	Het
Map3k19	T	A	1: 127,823,791	I303F		Het
Mymk	A	G	2: 27,067,856		probably benign	Het
Myo10	G	A	15: 25,800,109	V1424M	probably damaging	Het
Myof	T	G	19: 37,921,433	Q1528P	probably damaging	Het
Ncapd3	T	C	9: 27,094,742		probably benign	Het
Nup214	T	A	2: 31,994,726	Y500N	possibly damaging	Het
Olfr1040	T	C	2: 86,146,194	D180G	probably damaging	Het
Papd4	C	T	13: 93,175,569	G208S	probably damaging	Het
Pappa2	T	C	1: 158,854,973	Y835C	probably damaging	Het
Pcdh18	T	C	3: 49,756,581	E95G	probably damaging	Het
Phf3	A	T	1: 30,831,057	N303K	possibly damaging	Het
Pnn	C	T	12: 59,072,577	H649Y	unknown	Het
Ralgapa2	A	T	2: 146,333,450	M1762K	possibly damaging	Het
Rif1	G	A	2: 52,090,278	A496T	noncoding transcript	Het
Rnase13	A	T	14: 51,922,457	V75D	probably damaging	Het
Sema3c	G	A	5: 17,676,539		probably benign	Het
Sema4c	C	G	1: 36,552,885	G266R	probably damaging	Het
Slfn5	A	T	11: 82,956,550	D87V	probably damaging	Het
Smpd3	T	C	8: 106,264,658	Y421C	probably damaging	Het
Snrnp40	T	C	4: 130,378,074	V188A	probably benign	Het
Srms	A	G	2: 181,212,550	Y75H	probably benign	Het
Tex15	T	C	8: 33,582,362	S2646P	probably benign	Het
Togaram1	A	G	12: 64,995,556	I1130V	probably benign	Het
Ttf1	A	G	2: 29,064,677	K18E	possibly damaging	Het
Unc5b	G	T	10: 60,768,334	T827K	probably benign	Het
Zfhx2	T	A	14: 55,065,512	T1672S	possibly damaging	Het

Other mutations in Rab11fip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01505:Rab11fip1	APN	8	27154776	missense	possibly damaging	0.71
IGL01976:Rab11fip1	APN	8	27152797	missense	possibly damaging	0.56
IGL02832:Rab11fip1	APN	8	27152812	missense	possibly damaging	0.79
IGL02799:Rab11fip1	UTSW	8	27152760	missense	probably benign	0.12
R0046:Rab11fip1	UTSW	8	27153121	missense	probably damaging	0.99
R0046:Rab11fip1	UTSW	8	27153121	missense	probably damaging	0.99
R0145:Rab11fip1	UTSW	8	27143324	missense	probably damaging	1.00
R0243:Rab11fip1	UTSW	8	27152225	missense	probably damaging	1.00
R0427:Rab11fip1	UTSW	8	27154492	missense	probably damaging	0.99
R1341:Rab11fip1	UTSW	8	27143360	missense	probably damaging	0.99
R1487:Rab11fip1	UTSW	8	27154212	missense	probably damaging	0.99
R1509:Rab11fip1	UTSW	8	27153023	missense	probably damaging	1.00
R1731:Rab11fip1	UTSW	8	27152410	missense	probably damaging	0.98
R3832:Rab11fip1	UTSW	8	27152746	missense	probably benign
R4157:Rab11fip1	UTSW	8	27152147	missense	probably damaging	1.00
R4451:Rab11fip1	UTSW	8	27154477	missense	probably damaging	1.00
R4595:Rab11fip1	UTSW	8	27154575	missense	probably damaging	0.98
R4620:Rab11fip1	UTSW	8	27154215	missense	probably damaging	1.00
R4753:Rab11fip1	UTSW	8	27152741	missense	probably benign
R4834:Rab11fip1	UTSW	8	27153083	missense	probably damaging	1.00
R4958:Rab11fip1	UTSW	8	27154813	missense	probably damaging	0.99
R5102:Rab11fip1	UTSW	8	27156374	missense	probably damaging	0.99
R5558:Rab11fip1	UTSW	8	27151975	missense	probably damaging	1.00
R5752:Rab11fip1	UTSW	8	27156586	missense	probably damaging	0.99
R5859:Rab11fip1	UTSW	8	27154720	missense	probably damaging	1.00
R6525:Rab11fip1	UTSW	8	27156499	missense	probably benign	0.45
R6527:Rab11fip1	UTSW	8	27174392	missense	probably damaging	0.99
R6551:Rab11fip1	UTSW	8	27156484	missense	probably damaging	0.96
R6695:Rab11fip1	UTSW	8	27143234	missense	probably damaging	1.00
R6730:Rab11fip1	UTSW	8	27143229	missense	probably damaging	1.00
R6810:Rab11fip1	UTSW	8	27152732	frame shift	probably null
R6925:Rab11fip1	UTSW	8	27152972	missense	probably damaging	1.00
R6941:Rab11fip1	UTSW	8	27156275	nonsense	probably null
R7481:Rab11fip1	UTSW	8	27156581	missense	probably damaging	1.00
R7504:Rab11fip1	UTSW	8	27152953	missense	possibly damaging	0.78
R7610:Rab11fip1	UTSW	8	27152036	missense	probably benign	0.19
R8360:Rab11fip1	UTSW	8	27152346	nonsense	probably null
R8958:Rab11fip1	UTSW	8	27154912	missense	possibly damaging	0.91
R9025:Rab11fip1	UTSW	8	27154708	missense	probably benign	0.00
R9093:Rab11fip1	UTSW	8	27143327	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCATCCATCAAAGGCTGGG -3'
(R):5'- GATGGCGGAATGACTACAGC -3'

Sequencing Primer
(F):5'- GTACCTCTTGCTGGGCTG -3'
(R):5'- TCTTCTAGAGGACGAGGCCTC -3'

Posted On

2020-07-28