Mutagenetix > Incidental Mutation

Incidental Mutation 'R8264:Ncapd3'

639732

Institutional Source

Beutler Lab

Gene Symbol

Ncapd3

Ensembl Gene

ENSMUSG00000035024

Gene Name

non-SMC condensin II complex, subunit D3

Synonyms

4632407J06Rik, B130055D15Rik, 2810487N22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R8264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27030175-27095315 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 27094742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034472] [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034472

SMART Domains

Protein: ENSMUSP00000034472
Gene: ENSMUSG00000031990

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	38	136	2.7e-9	SMART
IGc2	151	226	8.12e-13	SMART
transmembrane domain	245	267	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000073127

SMART Domains

Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024

Domain	Start	End	E-Value	Type
low complexity region	159	170	N/A	INTRINSIC
low complexity region	173	184	N/A	INTRINSIC
Pfam:Cnd1	949	1148	1.7e-46	PFAM
low complexity region	1192	1200	N/A	INTRINSIC
coiled coil region	1213	1270	N/A	INTRINSIC
low complexity region	1290	1315	N/A	INTRINSIC
low complexity region	1393	1410	N/A	INTRINSIC
low complexity region	1485	1498	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000086198
AA Change: S1212P

SMART Domains

Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024
AA Change: S1212P

Domain	Start	End	E-Value	Type
low complexity region	159	170	N/A	INTRINSIC
low complexity region	173	184	N/A	INTRINSIC
Pfam:Cohesin_HEAT	536	560	4.6e-5	PFAM
Pfam:Cnd1	949	1148	6.6e-59	PFAM
low complexity region	1192	1200	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214432

Predicted Effect

silent
Transcript: ENSMUST00000216677

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217654

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,782	C911S	probably damaging	Het
Abcc4	T	A	14: 118,594,842	N792I	possibly damaging	Het
Acacb	A	T	5: 114,207,366	H960L	probably benign	Het
Aox1	A	G	1: 58,053,714	T162A	possibly damaging	Het
Cacna1g	T	C	11: 94,473,566	S18G	probably benign	Het
Chfr	T	A	5: 110,152,434	I348N	possibly damaging	Het
Cntln	G	A	4: 85,098,411	R12Q	probably damaging	Het
Cyp2c40	A	G	19: 39,807,527	S136P	possibly damaging	Het
Dnah14	T	A	1: 181,744,792	M2896K	probably damaging	Het
Elp6	A	G	9: 110,319,687	T215A	probably damaging	Het
Esyt2	A	C	12: 116,365,920	Q699H	probably benign	Het
Fbxo25	A	G	8: 13,929,393	T204A	possibly damaging	Het
Fhdc1	A	G	3: 84,455,032	S294P	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Galnt10	A	G	11: 57,782,206	I463V	probably benign	Het
Glce	A	G	9: 62,060,430	F480L	probably benign	Het
H2-Aa	A	G	17: 34,287,735	V11A	probably benign	Het
Hsd17b4	A	G	18: 50,146,526	T191A	possibly damaging	Het
Itpr3	G	T	17: 27,104,112		silent	Het
Izumo4	G	T	10: 80,702,738	G8V		Het
Klk1b5	T	A	7: 44,220,030	L178H	probably damaging	Het
Lama2	T	C	10: 27,467,222	N85D	probably benign	Het
Liph	A	C	16: 21,983,971	I116R	possibly damaging	Het
Lpar5	T	A	6: 125,081,502	V62D	probably damaging	Het
Map3k19	T	A	1: 127,823,791	I303F		Het
Mymk	A	G	2: 27,067,856		probably benign	Het
Myo10	G	A	15: 25,800,109	V1424M	probably damaging	Het
Myof	T	G	19: 37,921,433	Q1528P	probably damaging	Het
Nup214	T	A	2: 31,994,726	Y500N	possibly damaging	Het
Olfr1040	T	C	2: 86,146,194	D180G	probably damaging	Het
Papd4	C	T	13: 93,175,569	G208S	probably damaging	Het
Pappa2	T	C	1: 158,854,973	Y835C	probably damaging	Het
Pcdh18	T	C	3: 49,756,581	E95G	probably damaging	Het
Phf3	A	T	1: 30,831,057	N303K	possibly damaging	Het
Pnn	C	T	12: 59,072,577	H649Y	unknown	Het
Rab11fip1	G	A	8: 27,152,480	Q764*	probably null	Het
Ralgapa2	A	T	2: 146,333,450	M1762K	possibly damaging	Het
Rif1	G	A	2: 52,090,278	A496T	noncoding transcript	Het
Rnase13	A	T	14: 51,922,457	V75D	probably damaging	Het
Sema3c	G	A	5: 17,676,539		probably benign	Het
Sema4c	C	G	1: 36,552,885	G266R	probably damaging	Het
Slfn5	A	T	11: 82,956,550	D87V	probably damaging	Het
Smpd3	T	C	8: 106,264,658	Y421C	probably damaging	Het
Snrnp40	T	C	4: 130,378,074	V188A	probably benign	Het
Srms	A	G	2: 181,212,550	Y75H	probably benign	Het
Tex15	T	C	8: 33,582,362	S2646P	probably benign	Het
Togaram1	A	G	12: 64,995,556	I1130V	probably benign	Het
Ttf1	A	G	2: 29,064,677	K18E	possibly damaging	Het
Unc5b	G	T	10: 60,768,334	T827K	probably benign	Het
Zfhx2	T	A	14: 55,065,512	T1672S	possibly damaging	Het

Other mutations in Ncapd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Ncapd3	APN	9	27052353	missense	probably benign
IGL00544:Ncapd3	APN	9	27063338	missense	possibly damaging	0.94
IGL01657:Ncapd3	APN	9	27071824	missense	possibly damaging	0.81
IGL01979:Ncapd3	APN	9	27071965	critical splice donor site	probably null
IGL02073:Ncapd3	APN	9	27063316	missense	probably benign	0.03
IGL02083:Ncapd3	APN	9	27051821	missense	probably damaging	1.00
IGL02383:Ncapd3	APN	9	27050328	missense	probably benign	0.44
IGL02429:Ncapd3	APN	9	27089302	missense	probably benign	0.08
IGL02437:Ncapd3	APN	9	27063968	splice site	probably benign
IGL02861:Ncapd3	APN	9	27069899	missense	probably benign	0.00
IGL03202:Ncapd3	APN	9	27071715	splice site	probably benign
IGL03219:Ncapd3	APN	9	27063873	splice site	probably benign
IGL03252:Ncapd3	APN	9	27051449	missense	probably damaging	1.00
pevensie	UTSW	9	27086046	missense	probably damaging	1.00
R0015:Ncapd3	UTSW	9	27051809	missense	probably damaging	1.00
R0015:Ncapd3	UTSW	9	27051809	missense	probably damaging	1.00
R0084:Ncapd3	UTSW	9	27056111	missense	probably damaging	0.98
R0491:Ncapd3	UTSW	9	27057883	missense	probably damaging	0.97
R0513:Ncapd3	UTSW	9	27064105	splice site	probably benign
R0565:Ncapd3	UTSW	9	27087998	missense	probably benign	0.00
R0601:Ncapd3	UTSW	9	27041507	missense	probably benign	0.05
R0671:Ncapd3	UTSW	9	27087477	missense	probably benign	0.00
R0673:Ncapd3	UTSW	9	27087477	missense	probably benign	0.00
R0842:Ncapd3	UTSW	9	27037084	missense	probably benign	0.01
R1178:Ncapd3	UTSW	9	27041421	missense	probably benign
R1366:Ncapd3	UTSW	9	27057940	missense	probably damaging	1.00
R1432:Ncapd3	UTSW	9	27069872	splice site	probably benign
R1439:Ncapd3	UTSW	9	27087566	critical splice donor site	probably null
R1532:Ncapd3	UTSW	9	27083360	nonsense	probably null
R2131:Ncapd3	UTSW	9	27083346	missense	probably damaging	0.98
R2178:Ncapd3	UTSW	9	27088549	missense	probably benign	0.01
R2238:Ncapd3	UTSW	9	27067024	missense	probably benign
R2258:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2259:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2260:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2297:Ncapd3	UTSW	9	27041501	nonsense	probably null
R2877:Ncapd3	UTSW	9	27044487	splice site	probably null
R3612:Ncapd3	UTSW	9	27050357	missense	probably damaging	1.00
R3709:Ncapd3	UTSW	9	27052349	missense	probably benign	0.00
R3791:Ncapd3	UTSW	9	27052635	missense	probably benign	0.27
R4052:Ncapd3	UTSW	9	27089383	splice site	probably null
R4297:Ncapd3	UTSW	9	27052327	missense	probably benign
R4299:Ncapd3	UTSW	9	27052327	missense	probably benign
R4441:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R4572:Ncapd3	UTSW	9	27094615	missense	probably damaging	1.00
R4675:Ncapd3	UTSW	9	27094742	unclassified	probably benign
R4790:Ncapd3	UTSW	9	27051850	missense	probably benign	0.00
R4835:Ncapd3	UTSW	9	27086046	missense	probably damaging	1.00
R4919:Ncapd3	UTSW	9	27051775	missense	possibly damaging	0.95
R4928:Ncapd3	UTSW	9	27071735	nonsense	probably null
R4939:Ncapd3	UTSW	9	27063869	critical splice donor site	probably null
R4980:Ncapd3	UTSW	9	27063295	missense	probably damaging	0.99
R5030:Ncapd3	UTSW	9	27071766	missense	probably damaging	0.98
R5052:Ncapd3	UTSW	9	27051719	missense	probably damaging	1.00
R5180:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R5343:Ncapd3	UTSW	9	27088053	small deletion	probably benign
R5656:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R5840:Ncapd3	UTSW	9	27094758	missense	probably benign	0.00
R5900:Ncapd3	UTSW	9	27066969	missense	probably benign	0.26
R6093:Ncapd3	UTSW	9	27056158	missense	probably damaging	0.99
R6122:Ncapd3	UTSW	9	27063982	missense	probably benign	0.00
R6249:Ncapd3	UTSW	9	27088053	small deletion	probably benign
R6428:Ncapd3	UTSW	9	27052664	splice site	probably null
R6432:Ncapd3	UTSW	9	27044509	missense	probably damaging	0.98
R6441:Ncapd3	UTSW	9	27063416	missense	probably benign	0.03
R6459:Ncapd3	UTSW	9	27051755	missense	probably benign	0.00
R6567:Ncapd3	UTSW	9	27067004	missense	possibly damaging	0.83
R6722:Ncapd3	UTSW	9	27087556	missense	probably benign
R6862:Ncapd3	UTSW	9	27030809	missense	probably damaging	0.98
R7234:Ncapd3	UTSW	9	27050359	missense	probably damaging	0.97
R7286:Ncapd3	UTSW	9	27069958	missense	probably damaging	1.00
R7404:Ncapd3	UTSW	9	27067019	missense	probably benign	0.01
R7541:Ncapd3	UTSW	9	27067040	missense	probably damaging	0.99
R7583:Ncapd3	UTSW	9	27071848	missense	probably damaging	1.00
R7655:Ncapd3	UTSW	9	27055505	missense	possibly damaging	0.47
R7656:Ncapd3	UTSW	9	27055505	missense	possibly damaging	0.47
R7815:Ncapd3	UTSW	9	27063440	nonsense	probably null
R7876:Ncapd3	UTSW	9	27045223	critical splice donor site	probably null
R7913:Ncapd3	UTSW	9	27048226	nonsense	probably null
R8068:Ncapd3	UTSW	9	27063361	missense	possibly damaging	0.66
R8147:Ncapd3	UTSW	9	27030718	start gained	probably benign
R8197:Ncapd3	UTSW	9	27086033	missense	probably damaging	0.98
R8353:Ncapd3	UTSW	9	27071804	missense	probably benign	0.03
R8539:Ncapd3	UTSW	9	27048224	missense	probably benign
R8839:Ncapd3	UTSW	9	27094434	missense
R8917:Ncapd3	UTSW	9	27088001	missense	probably benign
R8997:Ncapd3	UTSW	9	27048281	missense	probably damaging	1.00
R9215:Ncapd3	UTSW	9	27064090	missense	possibly damaging	0.51
R9393:Ncapd3	UTSW	9	27051386	missense	possibly damaging	0.54
R9412:Ncapd3	UTSW	9	27056155	nonsense	probably null
R9688:Ncapd3	UTSW	9	27056053	missense	probably benign	0.01
R9746:Ncapd3	UTSW	9	27063359	missense	probably benign
R9749:Ncapd3	UTSW	9	27045577	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CTTGTCAGAGAAACACGAAGCC -3'
(R):5'- GGTTAGACAAACACAAGCTGC -3'

Sequencing Primer
(F):5'- GCCCAAGAACAAGGAAGTGAC -3'
(R):5'- GACACACTGATGTCCTAGGCAG -3'

Posted On

2020-07-28