Mutagenetix > Incidental Mutation

Incidental Mutation 'R8264:Unc5b'

639736

Institutional Source

Beutler Lab

Gene Symbol

Unc5b

Ensembl Gene

ENSMUSG00000020099

Gene Name

unc-5 netrin receptor B

Synonyms

Unc5h2, D10Bwg0792e, 6330415E02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60762593-60831581 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 60768334 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 827 (T827K)

Ref Sequence

ENSEMBL: ENSMUSP00000077080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077925]

AlphaFold

Q8K1S3

PDB Structure

Crystal structure of the UNC5H2 death domain [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000077925
AA Change: T827K

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000077080
Gene: ENSMUSG00000020099
AA Change: T827K

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
IG_like	54	149	1.71e2	SMART
IGc2	165	232	2.58e-6	SMART
TSP1	249	300	8.21e-15	SMART
TSP1	305	354	2.61e-8	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
ZU5	541	644	1.91e-56	SMART
DEATH	852	943	5.55e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of receptors. This particular protein mediates the repulsive effect of netrin-1 and is a vascular netrin receptor. This encoded protein is also in a group of proteins called dependence receptors (DpRs) which are involved in pro- and anti-apoptotic processes. Many DpRs are involved in embryogenesis and in cancer progression. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a severely hypomorphic allele exhibit background sensitive lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,782	C911S	probably damaging	Het
Abcc4	T	A	14: 118,594,842	N792I	possibly damaging	Het
Acacb	A	T	5: 114,207,366	H960L	probably benign	Het
Aox1	A	G	1: 58,053,714	T162A	possibly damaging	Het
Cacna1g	T	C	11: 94,473,566	S18G	probably benign	Het
Chfr	T	A	5: 110,152,434	I348N	possibly damaging	Het
Cntln	G	A	4: 85,098,411	R12Q	probably damaging	Het
Cyp2c40	A	G	19: 39,807,527	S136P	possibly damaging	Het
Dnah14	T	A	1: 181,744,792	M2896K	probably damaging	Het
Elp6	A	G	9: 110,319,687	T215A	probably damaging	Het
Esyt2	A	C	12: 116,365,920	Q699H	probably benign	Het
Fbxo25	A	G	8: 13,929,393	T204A	possibly damaging	Het
Fhdc1	A	G	3: 84,455,032	S294P	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Galnt10	A	G	11: 57,782,206	I463V	probably benign	Het
Glce	A	G	9: 62,060,430	F480L	probably benign	Het
H2-Aa	A	G	17: 34,287,735	V11A	probably benign	Het
Hsd17b4	A	G	18: 50,146,526	T191A	possibly damaging	Het
Itpr3	G	T	17: 27,104,112		silent	Het
Izumo4	G	T	10: 80,702,738	G8V		Het
Klk1b5	T	A	7: 44,220,030	L178H	probably damaging	Het
Lama2	T	C	10: 27,467,222	N85D	probably benign	Het
Liph	A	C	16: 21,983,971	I116R	possibly damaging	Het
Lpar5	T	A	6: 125,081,502	V62D	probably damaging	Het
Map3k19	T	A	1: 127,823,791	I303F		Het
Mymk	A	G	2: 27,067,856		probably benign	Het
Myo10	G	A	15: 25,800,109	V1424M	probably damaging	Het
Myof	T	G	19: 37,921,433	Q1528P	probably damaging	Het
Ncapd3	T	C	9: 27,094,742		probably benign	Het
Nup214	T	A	2: 31,994,726	Y500N	possibly damaging	Het
Olfr1040	T	C	2: 86,146,194	D180G	probably damaging	Het
Papd4	C	T	13: 93,175,569	G208S	probably damaging	Het
Pappa2	T	C	1: 158,854,973	Y835C	probably damaging	Het
Pcdh18	T	C	3: 49,756,581	E95G	probably damaging	Het
Phf3	A	T	1: 30,831,057	N303K	possibly damaging	Het
Pnn	C	T	12: 59,072,577	H649Y	unknown	Het
Rab11fip1	G	A	8: 27,152,480	Q764*	probably null	Het
Ralgapa2	A	T	2: 146,333,450	M1762K	possibly damaging	Het
Rif1	G	A	2: 52,090,278	A496T	noncoding transcript	Het
Rnase13	A	T	14: 51,922,457	V75D	probably damaging	Het
Sema3c	G	A	5: 17,676,539		probably benign	Het
Sema4c	C	G	1: 36,552,885	G266R	probably damaging	Het
Slfn5	A	T	11: 82,956,550	D87V	probably damaging	Het
Smpd3	T	C	8: 106,264,658	Y421C	probably damaging	Het
Snrnp40	T	C	4: 130,378,074	V188A	probably benign	Het
Srms	A	G	2: 181,212,550	Y75H	probably benign	Het
Tex15	T	C	8: 33,582,362	S2646P	probably benign	Het
Togaram1	A	G	12: 64,995,556	I1130V	probably benign	Het
Ttf1	A	G	2: 29,064,677	K18E	possibly damaging	Het
Zfhx2	T	A	14: 55,065,512	T1672S	possibly damaging	Het

Other mutations in Unc5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Unc5b	APN	10	60783216	missense	possibly damaging	0.73
IGL00578:Unc5b	APN	10	60767055	missense	probably damaging	1.00
IGL01895:Unc5b	APN	10	60767085	missense	probably damaging	1.00
IGL01955:Unc5b	APN	10	60778255	missense	probably benign	0.30
IGL01980:Unc5b	APN	10	60780187	missense	probably damaging	1.00
IGL02277:Unc5b	APN	10	60774742	missense	probably benign
LCD18:Unc5b	UTSW	10	60786171	intron	probably benign
R0021:Unc5b	UTSW	10	60778919	missense	probably benign	0.17
R0021:Unc5b	UTSW	10	60778919	missense	probably benign	0.17
R0026:Unc5b	UTSW	10	60774592	missense	possibly damaging	0.86
R0147:Unc5b	UTSW	10	60772297	missense	probably damaging	0.96
R0305:Unc5b	UTSW	10	60779658	splice site	probably benign
R0306:Unc5b	UTSW	10	60779658	splice site	probably benign
R0373:Unc5b	UTSW	10	60778940	missense	possibly damaging	0.78
R0662:Unc5b	UTSW	10	60772583	missense	possibly damaging	0.68
R1208:Unc5b	UTSW	10	60766992	missense	probably damaging	1.00
R1208:Unc5b	UTSW	10	60766992	missense	probably damaging	1.00
R1512:Unc5b	UTSW	10	60831475	unclassified	probably benign
R1532:Unc5b	UTSW	10	60769232	missense	probably damaging	0.99
R1916:Unc5b	UTSW	10	60778248	missense	probably damaging	1.00
R1931:Unc5b	UTSW	10	60772569	missense	probably benign	0.30
R1954:Unc5b	UTSW	10	60769265	splice site	probably benign
R2350:Unc5b	UTSW	10	60778200	missense	probably benign	0.04
R3419:Unc5b	UTSW	10	60778814	missense	probably damaging	1.00
R4116:Unc5b	UTSW	10	60774700	missense	probably damaging	0.99
R4258:Unc5b	UTSW	10	60765371	missense	probably damaging	0.99
R4329:Unc5b	UTSW	10	60783190	missense	probably damaging	1.00
R4605:Unc5b	UTSW	10	60774403	missense	probably benign	0.01
R4828:Unc5b	UTSW	10	60772348	missense	possibly damaging	0.90
R5134:Unc5b	UTSW	10	60775100	missense	probably benign	0.09
R5190:Unc5b	UTSW	10	60772293	missense	probably benign	0.04
R5240:Unc5b	UTSW	10	60774640	missense	probably damaging	0.99
R5342:Unc5b	UTSW	10	60778267	nonsense	probably null
R5522:Unc5b	UTSW	10	60778195	missense	possibly damaging	0.91
R5694:Unc5b	UTSW	10	60773747	missense	probably benign	0.02
R5822:Unc5b	UTSW	10	60772527	missense	possibly damaging	0.71
R5909:Unc5b	UTSW	10	60772359	missense	probably damaging	1.00
R6007:Unc5b	UTSW	10	60765360	missense	probably damaging	1.00
R6115:Unc5b	UTSW	10	60777546	missense	probably benign	0.33
R6182:Unc5b	UTSW	10	60765236	missense	probably damaging	1.00
R6187:Unc5b	UTSW	10	60772224	missense	probably damaging	1.00
R6294:Unc5b	UTSW	10	60778331	missense	possibly damaging	0.82
R6319:Unc5b	UTSW	10	60778801	missense	probably damaging	1.00
R6366:Unc5b	UTSW	10	60778312	missense	probably benign
R6532:Unc5b	UTSW	10	60778828	missense	possibly damaging	0.95
R6827:Unc5b	UTSW	10	60780232	missense	probably benign
R6912:Unc5b	UTSW	10	60831092	missense	probably benign
R7032:Unc5b	UTSW	10	60778808	missense	probably damaging	0.99
R7082:Unc5b	UTSW	10	60775088	missense	probably damaging	0.98
R7089:Unc5b	UTSW	10	60777486	missense	probably damaging	1.00
R7270:Unc5b	UTSW	10	60772223	nonsense	probably null
R7587:Unc5b	UTSW	10	60783120	missense	probably damaging	1.00
R7716:Unc5b	UTSW	10	60777438	missense	probably damaging	1.00
R7750:Unc5b	UTSW	10	60775044	missense	probably benign	0.00
R7810:Unc5b	UTSW	10	60765241	missense	probably benign
R7895:Unc5b	UTSW	10	60779730	missense	possibly damaging	0.65
R7942:Unc5b	UTSW	10	60777543	missense	probably damaging	1.00
R9100:Unc5b	UTSW	10	60768373	missense	probably damaging	1.00
R9188:Unc5b	UTSW	10	60773771	missense	probably damaging	1.00
R9287:Unc5b	UTSW	10	60773753	missense	possibly damaging	0.88
R9441:Unc5b	UTSW	10	60772249	missense	probably damaging	1.00
R9664:Unc5b	UTSW	10	60777543	missense	probably damaging	1.00
RF019:Unc5b	UTSW	10	60783183	missense	probably damaging	1.00
X0027:Unc5b	UTSW	10	60777459	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGACCATTATAACCCTATCCC -3'
(R):5'- ACCTTTCCTGCAGGAGATTCC -3'

Sequencing Primer
(F):5'- CCATAGGCATGATACCTCGTATGG -3'
(R):5'- GCAGGAGATTCCCTTCTACCACG -3'

Posted On

2020-07-28