Incidental Mutation 'R8264:Galnt10'
ID 639738
Institutional Source Beutler Lab
Gene Symbol Galnt10
Ensembl Gene ENSMUSG00000020520
Gene Name polypeptide N-acetylgalactosaminyltransferase 10
Synonyms C330012K04Rik, GalNAc-T10, Galnt9
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8264 (G1)
Quality Score 174.009
Status Validated
Chromosome 11
Chromosomal Location 57536268-57678327 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57673032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 463 (I463V)
Ref Sequence ENSEMBL: ENSMUSP00000065096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066987]
AlphaFold Q6P9S7
Predicted Effect probably benign
Transcript: ENSMUST00000066987
AA Change: I463V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000065096
Gene: ENSMUSG00000020520
AA Change: I463V

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 145 376 4.7e-8 PFAM
Pfam:Glycos_transf_2 148 333 1.9e-37 PFAM
Pfam:Glyco_tranf_2_2 148 373 3e-7 PFAM
Pfam:Glyco_transf_7C 303 376 2.3e-11 PFAM
RICIN 460 590 4.29e-31 SMART
Meta Mutation Damage Score 0.1415 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GalNAc polypeptide N-acetylgalactosaminyltransferases. These enzymes catalyze the first step in the synthesis of mucin-type oligosaccharides. These proteins transfer GalNAc from UDP-GalNAc to either serine or threonine residues of polypeptide acceptors. The protein encoded by this locus may have increased catalytic activity toward glycosylated peptides compared to activity toward non-glycosylated peptides.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Galnt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Galnt10 APN 11 57,616,409 (GRCm39) missense probably damaging 1.00
IGL02085:Galnt10 APN 11 57,673,104 (GRCm39) missense probably benign
IGL02154:Galnt10 APN 11 57,675,531 (GRCm39) missense probably damaging 1.00
IGL02418:Galnt10 APN 11 57,671,994 (GRCm39) missense probably benign 0.00
IGL02810:Galnt10 APN 11 57,616,412 (GRCm39) missense probably damaging 0.99
IGL03070:Galnt10 APN 11 57,616,408 (GRCm39) missense probably damaging 1.00
IGL03191:Galnt10 APN 11 57,662,326 (GRCm39) missense probably damaging 1.00
R0257:Galnt10 UTSW 11 57,671,904 (GRCm39) missense probably damaging 1.00
R0483:Galnt10 UTSW 11 57,672,048 (GRCm39) missense probably damaging 1.00
R0681:Galnt10 UTSW 11 57,660,366 (GRCm39) missense probably damaging 1.00
R1102:Galnt10 UTSW 11 57,671,871 (GRCm39) splice site probably benign
R1436:Galnt10 UTSW 11 57,662,295 (GRCm39) missense probably damaging 1.00
R1959:Galnt10 UTSW 11 57,656,443 (GRCm39) missense probably damaging 1.00
R3424:Galnt10 UTSW 11 57,536,539 (GRCm39) missense probably benign
R4445:Galnt10 UTSW 11 57,674,517 (GRCm39) missense probably damaging 0.98
R5183:Galnt10 UTSW 11 57,660,414 (GRCm39) missense probably damaging 1.00
R5369:Galnt10 UTSW 11 57,656,573 (GRCm39) critical splice donor site probably null
R5838:Galnt10 UTSW 11 57,671,882 (GRCm39) missense probably damaging 0.99
R6045:Galnt10 UTSW 11 57,674,619 (GRCm39) missense probably damaging 1.00
R6148:Galnt10 UTSW 11 57,675,474 (GRCm39) missense probably damaging 1.00
R6442:Galnt10 UTSW 11 57,656,448 (GRCm39) missense probably benign 0.03
R6851:Galnt10 UTSW 11 57,656,458 (GRCm39) missense probably damaging 1.00
R6873:Galnt10 UTSW 11 57,672,045 (GRCm39) missense probably damaging 1.00
R7013:Galnt10 UTSW 11 57,656,410 (GRCm39) missense probably benign 0.22
R7696:Galnt10 UTSW 11 57,660,364 (GRCm39) missense probably damaging 1.00
R7950:Galnt10 UTSW 11 57,674,549 (GRCm39) missense probably damaging 0.99
R8208:Galnt10 UTSW 11 57,536,398 (GRCm39) missense possibly damaging 0.85
R8743:Galnt10 UTSW 11 57,675,409 (GRCm39) missense probably damaging 1.00
R8924:Galnt10 UTSW 11 57,674,681 (GRCm39) intron probably benign
R9143:Galnt10 UTSW 11 57,612,146 (GRCm39) missense probably benign
R9508:Galnt10 UTSW 11 57,673,040 (GRCm39) missense possibly damaging 0.94
R9760:Galnt10 UTSW 11 57,656,514 (GRCm39) missense probably benign
R9777:Galnt10 UTSW 11 57,672,065 (GRCm39) missense probably damaging 0.98
Z1088:Galnt10 UTSW 11 57,612,157 (GRCm39) missense possibly damaging 0.93
Z1177:Galnt10 UTSW 11 57,627,826 (GRCm39) missense probably benign 0.43
Z1186:Galnt10 UTSW 11 57,656,514 (GRCm39) missense probably benign
Z1187:Galnt10 UTSW 11 57,656,514 (GRCm39) missense probably benign
Z1188:Galnt10 UTSW 11 57,656,514 (GRCm39) missense probably benign
Z1189:Galnt10 UTSW 11 57,656,514 (GRCm39) missense probably benign
Z1190:Galnt10 UTSW 11 57,656,514 (GRCm39) missense probably benign
Z1191:Galnt10 UTSW 11 57,656,514 (GRCm39) missense probably benign
Z1192:Galnt10 UTSW 11 57,656,514 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTGCTCTCAGTGTGAGG -3'
(R):5'- CTCTGGGAGTTCTGAGACTCATC -3'

Sequencing Primer
(F):5'- GAGAAGGACCTTGCCCTACAG -3'
(R):5'- ATCTCCTGGCTGACAACTGAC -3'
Posted On 2020-07-28