Mutagenetix > Incidental Mutation

Incidental Mutation 'R8264:Galnt10'

639738

Institutional Source

Beutler Lab

Gene Symbol

Galnt10

Ensembl Gene

ENSMUSG00000020520

Gene Name

polypeptide N-acetylgalactosaminyltransferase 10

Synonyms

Galnt9, C330012K04Rik, GalNAc-T10

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8264 (G1)

Quality Score

174.009

Status

Validated

Chromosome

Chromosomal Location

57645442-57787514 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57782206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 463 (I463V)

Ref Sequence

ENSEMBL: ENSMUSP00000065096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066987]

AlphaFold

Q6P9S7

Predicted Effect

probably benign
Transcript: ENSMUST00000066987
AA Change: I463V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000065096
Gene: ENSMUSG00000020520
AA Change: I463V

Domain	Start	End	E-Value	Type
transmembrane domain	12	31	N/A	INTRINSIC
low complexity region	38	52	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	145	376	4.7e-8	PFAM
Pfam:Glycos_transf_2	148	333	1.9e-37	PFAM
Pfam:Glyco_tranf_2_2	148	373	3e-7	PFAM
Pfam:Glyco_transf_7C	303	376	2.3e-11	PFAM
RICIN	460	590	4.29e-31	SMART

Meta Mutation Damage Score

0.1415

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GalNAc polypeptide N-acetylgalactosaminyltransferases. These enzymes catalyze the first step in the synthesis of mucin-type oligosaccharides. These proteins transfer GalNAc from UDP-GalNAc to either serine or threonine residues of polypeptide acceptors. The protein encoded by this locus may have increased catalytic activity toward glycosylated peptides compared to activity toward non-glycosylated peptides.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,782	C911S	probably damaging	Het
Abcc4	T	A	14: 118,594,842	N792I	possibly damaging	Het
Acacb	A	T	5: 114,207,366	H960L	probably benign	Het
Aox1	A	G	1: 58,053,714	T162A	possibly damaging	Het
Cacna1g	T	C	11: 94,473,566	S18G	probably benign	Het
Chfr	T	A	5: 110,152,434	I348N	possibly damaging	Het
Cntln	G	A	4: 85,098,411	R12Q	probably damaging	Het
Cyp2c40	A	G	19: 39,807,527	S136P	possibly damaging	Het
Dnah14	T	A	1: 181,744,792	M2896K	probably damaging	Het
Elp6	A	G	9: 110,319,687	T215A	probably damaging	Het
Esyt2	A	C	12: 116,365,920	Q699H	probably benign	Het
Fbxo25	A	G	8: 13,929,393	T204A	possibly damaging	Het
Fhdc1	A	G	3: 84,455,032	S294P	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Glce	A	G	9: 62,060,430	F480L	probably benign	Het
H2-Aa	A	G	17: 34,287,735	V11A	probably benign	Het
Hsd17b4	A	G	18: 50,146,526	T191A	possibly damaging	Het
Itpr3	G	T	17: 27,104,112		silent	Het
Izumo4	G	T	10: 80,702,738	G8V		Het
Klk1b5	T	A	7: 44,220,030	L178H	probably damaging	Het
Lama2	T	C	10: 27,467,222	N85D	probably benign	Het
Liph	A	C	16: 21,983,971	I116R	possibly damaging	Het
Lpar5	T	A	6: 125,081,502	V62D	probably damaging	Het
Map3k19	T	A	1: 127,823,791	I303F		Het
Mymk	A	G	2: 27,067,856		probably benign	Het
Myo10	G	A	15: 25,800,109	V1424M	probably damaging	Het
Myof	T	G	19: 37,921,433	Q1528P	probably damaging	Het
Ncapd3	T	C	9: 27,094,742		probably benign	Het
Nup214	T	A	2: 31,994,726	Y500N	possibly damaging	Het
Olfr1040	T	C	2: 86,146,194	D180G	probably damaging	Het
Papd4	C	T	13: 93,175,569	G208S	probably damaging	Het
Pappa2	T	C	1: 158,854,973	Y835C	probably damaging	Het
Pcdh18	T	C	3: 49,756,581	E95G	probably damaging	Het
Phf3	A	T	1: 30,831,057	N303K	possibly damaging	Het
Pnn	C	T	12: 59,072,577	H649Y	unknown	Het
Rab11fip1	G	A	8: 27,152,480	Q764*	probably null	Het
Ralgapa2	A	T	2: 146,333,450	M1762K	possibly damaging	Het
Rif1	G	A	2: 52,090,278	A496T	noncoding transcript	Het
Rnase13	A	T	14: 51,922,457	V75D	probably damaging	Het
Sema3c	G	A	5: 17,676,539		probably benign	Het
Sema4c	C	G	1: 36,552,885	G266R	probably damaging	Het
Slfn5	A	T	11: 82,956,550	D87V	probably damaging	Het
Smpd3	T	C	8: 106,264,658	Y421C	probably damaging	Het
Snrnp40	T	C	4: 130,378,074	V188A	probably benign	Het
Srms	A	G	2: 181,212,550	Y75H	probably benign	Het
Tex15	T	C	8: 33,582,362	S2646P	probably benign	Het
Togaram1	A	G	12: 64,995,556	I1130V	probably benign	Het
Ttf1	A	G	2: 29,064,677	K18E	possibly damaging	Het
Unc5b	G	T	10: 60,768,334	T827K	probably benign	Het
Zfhx2	T	A	14: 55,065,512	T1672S	possibly damaging	Het

Other mutations in Galnt10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01367:Galnt10	APN	11	57725583	missense	probably damaging	1.00
IGL02085:Galnt10	APN	11	57782278	missense	probably benign
IGL02154:Galnt10	APN	11	57784705	missense	probably damaging	1.00
IGL02418:Galnt10	APN	11	57781168	missense	probably benign	0.00
IGL02810:Galnt10	APN	11	57725586	missense	probably damaging	0.99
IGL03070:Galnt10	APN	11	57725582	missense	probably damaging	1.00
IGL03191:Galnt10	APN	11	57771500	missense	probably damaging	1.00
R0257:Galnt10	UTSW	11	57781078	missense	probably damaging	1.00
R0483:Galnt10	UTSW	11	57781222	missense	probably damaging	1.00
R0681:Galnt10	UTSW	11	57769540	missense	probably damaging	1.00
R1102:Galnt10	UTSW	11	57781045	splice site	probably benign
R1436:Galnt10	UTSW	11	57771469	missense	probably damaging	1.00
R1959:Galnt10	UTSW	11	57765617	missense	probably damaging	1.00
R3424:Galnt10	UTSW	11	57645713	missense	probably benign
R4445:Galnt10	UTSW	11	57783691	missense	probably damaging	0.98
R5183:Galnt10	UTSW	11	57769588	missense	probably damaging	1.00
R5369:Galnt10	UTSW	11	57765747	critical splice donor site	probably null
R5838:Galnt10	UTSW	11	57781056	missense	probably damaging	0.99
R6045:Galnt10	UTSW	11	57783793	missense	probably damaging	1.00
R6148:Galnt10	UTSW	11	57784648	missense	probably damaging	1.00
R6442:Galnt10	UTSW	11	57765622	missense	probably benign	0.03
R6851:Galnt10	UTSW	11	57765632	missense	probably damaging	1.00
R6873:Galnt10	UTSW	11	57781219	missense	probably damaging	1.00
R7013:Galnt10	UTSW	11	57765584	missense	probably benign	0.22
R7696:Galnt10	UTSW	11	57769538	missense	probably damaging	1.00
R7950:Galnt10	UTSW	11	57783723	missense	probably damaging	0.99
R8208:Galnt10	UTSW	11	57645572	missense	possibly damaging	0.85
R8743:Galnt10	UTSW	11	57784583	missense	probably damaging	1.00
R8924:Galnt10	UTSW	11	57783855	intron	probably benign
R9143:Galnt10	UTSW	11	57721320	missense	probably benign
R9508:Galnt10	UTSW	11	57782214	missense	possibly damaging	0.94
R9760:Galnt10	UTSW	11	57765688	missense	probably benign
R9777:Galnt10	UTSW	11	57781239	missense	probably damaging	0.98
Z1088:Galnt10	UTSW	11	57721331	missense	possibly damaging	0.93
Z1177:Galnt10	UTSW	11	57737000	missense	probably benign	0.43
Z1186:Galnt10	UTSW	11	57765688	missense	probably benign
Z1187:Galnt10	UTSW	11	57765688	missense	probably benign
Z1188:Galnt10	UTSW	11	57765688	missense	probably benign
Z1189:Galnt10	UTSW	11	57765688	missense	probably benign
Z1190:Galnt10	UTSW	11	57765688	missense	probably benign
Z1191:Galnt10	UTSW	11	57765688	missense	probably benign
Z1192:Galnt10	UTSW	11	57765688	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAGTGCTCTCAGTGTGAGG -3'
(R):5'- CTCTGGGAGTTCTGAGACTCATC -3'

Sequencing Primer
(F):5'- GAGAAGGACCTTGCCCTACAG -3'
(R):5'- ATCTCCTGGCTGACAACTGAC -3'

Posted On

2020-07-28