Incidental Mutation 'R8264:Slfn5'
ID639739
Institutional Source Beutler Lab
Gene Symbol Slfn5
Ensembl Gene ENSMUSG00000054404
Gene Nameschlafen 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R8264 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location82951349-82964840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82956550 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 87 (D87V)
Ref Sequence ENSEMBL: ENSMUSP00000064819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067443] [ENSMUST00000108157] [ENSMUST00000108158]
Predicted Effect probably damaging
Transcript: ENSMUST00000067443
AA Change: D87V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064819
Gene: ENSMUSG00000054404
AA Change: D87V

DomainStartEndE-ValueType
Pfam:AlbA_2 187 319 4.7e-13 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 743 4.7e-8 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108157
AA Change: D87V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103792
Gene: ENSMUSG00000054404
AA Change: D87V

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 1.9e-15 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 739 9.4e-9 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108158
AA Change: D87V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103793
Gene: ENSMUSG00000054404
AA Change: D87V

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 3.4e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,782 C911S probably damaging Het
Abcc4 T A 14: 118,594,842 N792I possibly damaging Het
Acacb A T 5: 114,207,366 H960L probably benign Het
Aox1 A G 1: 58,053,714 T162A possibly damaging Het
Cacna1g T C 11: 94,473,566 S18G probably benign Het
Chfr T A 5: 110,152,434 I348N possibly damaging Het
Cntln G A 4: 85,098,411 R12Q probably damaging Het
Cyp2c40 A G 19: 39,807,527 S136P possibly damaging Het
Dnah14 T A 1: 181,744,792 M2896K probably damaging Het
Elp6 A G 9: 110,319,687 T215A probably damaging Het
Esyt2 A C 12: 116,365,920 Q699H probably benign Het
Fam179b A G 12: 64,995,556 I1130V probably benign Het
Fbxo25 A G 8: 13,929,393 T204A possibly damaging Het
Fhdc1 A G 3: 84,455,032 S294P probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Galnt10 A G 11: 57,782,206 I463V probably benign Het
Glce A G 9: 62,060,430 F480L probably benign Het
H2-Aa A G 17: 34,287,735 V11A probably benign Het
Hsd17b4 A G 18: 50,146,526 T191A possibly damaging Het
Izumo4 G T 10: 80,702,738 G8V Het
Klk1b5 T A 7: 44,220,030 L178H probably damaging Het
Lama2 T C 10: 27,467,222 N85D probably benign Het
Liph A C 16: 21,983,971 I116R possibly damaging Het
Lpar5 T A 6: 125,081,502 V62D probably damaging Het
Map3k19 T A 1: 127,823,791 I303F Het
Myo10 G A 15: 25,800,109 V1424M probably damaging Het
Myof T G 19: 37,921,433 Q1528P probably damaging Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Nup214 T A 2: 31,994,726 Y500N possibly damaging Het
Olfr1040 T C 2: 86,146,194 D180G probably damaging Het
Papd4 C T 13: 93,175,569 G208S probably damaging Het
Pappa2 T C 1: 158,854,973 Y835C probably damaging Het
Pcdh18 T C 3: 49,756,581 E95G probably damaging Het
Phf3 A T 1: 30,831,057 N303K possibly damaging Het
Pnn C T 12: 59,072,577 H649Y unknown Het
Rab11fip1 G A 8: 27,152,480 Q764* probably null Het
Ralgapa2 A T 2: 146,333,450 M1762K possibly damaging Het
Rif1 G A 2: 52,090,278 A496T noncoding transcript Het
Rnase13 A T 14: 51,922,457 V75D probably damaging Het
Sema4c C G 1: 36,552,885 G266R probably damaging Het
Smpd3 T C 8: 106,264,658 Y421C probably damaging Het
Snrnp40 T C 4: 130,378,074 V188A probably benign Het
Srms A G 2: 181,212,550 Y75H probably benign Het
Tex15 T C 8: 33,582,362 S2646P probably benign Het
Tmem8c A G 2: 27,067,856 probably benign Het
Ttf1 A G 2: 29,064,677 K18E possibly damaging Het
Unc5b G T 10: 60,768,334 T827K probably benign Het
Zfhx2 T A 14: 55,065,512 T1672S possibly damaging Het
Other mutations in Slfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Slfn5 APN 11 82956981 missense probably damaging 0.97
IGL01773:Slfn5 APN 11 82961331 missense probably damaging 1.00
IGL03026:Slfn5 APN 11 82956561 missense probably benign
IGL03368:Slfn5 APN 11 82956385 missense possibly damaging 0.88
R0531:Slfn5 UTSW 11 82961040 missense probably damaging 0.99
R0690:Slfn5 UTSW 11 82961403 missense probably damaging 1.00
R0939:Slfn5 UTSW 11 82961338 missense probably benign 0.04
R1005:Slfn5 UTSW 11 82960158 missense probably damaging 1.00
R1214:Slfn5 UTSW 11 82960091 missense probably benign 0.01
R1978:Slfn5 UTSW 11 82956616 missense probably benign 0.17
R4092:Slfn5 UTSW 11 82961067 missense probably damaging 1.00
R4620:Slfn5 UTSW 11 82961652 missense probably damaging 1.00
R4789:Slfn5 UTSW 11 82956400 missense probably benign 0.00
R5113:Slfn5 UTSW 11 82961696 missense probably benign 0.01
R5120:Slfn5 UTSW 11 82960928 missense probably damaging 1.00
R5262:Slfn5 UTSW 11 82956670 missense possibly damaging 0.56
R5307:Slfn5 UTSW 11 82956385 missense probably damaging 0.96
R5451:Slfn5 UTSW 11 82960086 missense probably damaging 1.00
R5498:Slfn5 UTSW 11 82957147 missense possibly damaging 0.84
R5651:Slfn5 UTSW 11 82960664 missense probably benign 0.00
R5777:Slfn5 UTSW 11 82961004 missense probably damaging 0.99
R5906:Slfn5 UTSW 11 82957276 missense probably benign 0.37
R5934:Slfn5 UTSW 11 82956592 missense probably damaging 1.00
R6521:Slfn5 UTSW 11 82960415 missense probably damaging 0.99
R6543:Slfn5 UTSW 11 82958666 splice site probably null
R6681:Slfn5 UTSW 11 82956378 missense possibly damaging 0.73
R7129:Slfn5 UTSW 11 82961150 nonsense probably null
R7309:Slfn5 UTSW 11 82956703 missense probably damaging 1.00
R7478:Slfn5 UTSW 11 82960616 missense probably damaging 1.00
R7573:Slfn5 UTSW 11 82958759 missense probably damaging 1.00
R7610:Slfn5 UTSW 11 82961484 missense probably damaging 1.00
R7834:Slfn5 UTSW 11 82960452 missense possibly damaging 0.88
R7957:Slfn5 UTSW 11 82956787 missense probably benign 0.00
R8205:Slfn5 UTSW 11 82960718 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAAATGGATACCACACACTGCATG -3'
(R):5'- GCGTCATCTACAGGAGCTTC -3'

Sequencing Primer
(F):5'- TGAAACAGAACGAAATCATCTCG -3'
(R):5'- ATTTAGCGAGTCAGAGTCACC -3'
Posted On2020-07-28