Incidental Mutation 'R8264:Togaram1'
ID 639742
Institutional Source Beutler Lab
Gene Symbol Togaram1
Ensembl Gene ENSMUSG00000035614
Gene Name TOG array regulator of axonemal microtubules 1
Synonyms A430041B07Rik, Fam179b
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.874) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 65012578-65069347 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65042330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1130 (I1130V)
Ref Sequence ENSEMBL: ENSMUSP00000070382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066296]
AlphaFold Q6A070
Predicted Effect probably benign
Transcript: ENSMUST00000066296
AA Change: I1130V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070382
Gene: ENSMUSG00000035614
AA Change: I1130V

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
TOG 339 574 3.38e-23 SMART
low complexity region 804 815 N/A INTRINSIC
low complexity region 988 1001 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1033 1041 N/A INTRINSIC
coiled coil region 1177 1206 N/A INTRINSIC
TOG 1251 1486 4.37e-8 SMART
TOG 1533 1776 1.53e-12 SMART
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
H2-Aa A G 17: 34,506,709 (GRCm39) V11A probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in Togaram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Togaram1 APN 12 65,053,173 (GRCm39) missense probably damaging 1.00
IGL01128:Togaram1 APN 12 65,027,650 (GRCm39) missense probably benign 0.01
IGL01406:Togaram1 APN 12 65,042,352 (GRCm39) missense possibly damaging 0.81
IGL01534:Togaram1 APN 12 65,013,321 (GRCm39) missense probably damaging 0.99
IGL01569:Togaram1 APN 12 65,029,436 (GRCm39) missense possibly damaging 0.81
IGL01927:Togaram1 APN 12 65,023,476 (GRCm39) missense probably benign 0.31
IGL02066:Togaram1 APN 12 65,030,195 (GRCm39) missense probably damaging 1.00
IGL02746:Togaram1 APN 12 65,013,270 (GRCm39) nonsense probably null
IGL02878:Togaram1 APN 12 65,039,400 (GRCm39) missense possibly damaging 0.60
IGL02947:Togaram1 APN 12 65,068,274 (GRCm39) missense probably damaging 1.00
IGL02961:Togaram1 APN 12 65,013,484 (GRCm39) missense probably damaging 1.00
PIT4810001:Togaram1 UTSW 12 65,030,286 (GRCm39) missense probably damaging 1.00
R0483:Togaram1 UTSW 12 65,053,805 (GRCm39) missense probably damaging 1.00
R0519:Togaram1 UTSW 12 65,012,776 (GRCm39) unclassified probably benign
R0584:Togaram1 UTSW 12 65,014,279 (GRCm39) missense probably damaging 1.00
R0646:Togaram1 UTSW 12 65,068,240 (GRCm39) missense probably damaging 1.00
R0749:Togaram1 UTSW 12 65,029,472 (GRCm39) missense possibly damaging 0.87
R0891:Togaram1 UTSW 12 65,029,421 (GRCm39) missense probably benign 0.01
R1111:Togaram1 UTSW 12 65,053,115 (GRCm39) missense probably damaging 1.00
R1349:Togaram1 UTSW 12 65,057,919 (GRCm39) missense probably damaging 0.99
R1531:Togaram1 UTSW 12 65,013,039 (GRCm39) missense probably benign 0.01
R1618:Togaram1 UTSW 12 65,013,847 (GRCm39) missense possibly damaging 0.47
R1672:Togaram1 UTSW 12 65,068,342 (GRCm39) missense probably benign 0.00
R1789:Togaram1 UTSW 12 65,049,409 (GRCm39) missense possibly damaging 0.47
R1822:Togaram1 UTSW 12 65,042,409 (GRCm39) missense probably damaging 0.98
R1930:Togaram1 UTSW 12 65,013,709 (GRCm39) missense probably damaging 1.00
R1931:Togaram1 UTSW 12 65,013,709 (GRCm39) missense probably damaging 1.00
R2006:Togaram1 UTSW 12 65,065,914 (GRCm39) missense probably damaging 1.00
R2018:Togaram1 UTSW 12 65,049,433 (GRCm39) missense possibly damaging 0.76
R2304:Togaram1 UTSW 12 65,023,630 (GRCm39) splice site probably null
R2345:Togaram1 UTSW 12 65,055,406 (GRCm39) missense probably benign 0.05
R2407:Togaram1 UTSW 12 65,014,444 (GRCm39) missense probably damaging 1.00
R2853:Togaram1 UTSW 12 65,063,386 (GRCm39) missense probably benign 0.40
R3123:Togaram1 UTSW 12 65,013,118 (GRCm39) missense probably damaging 1.00
R3124:Togaram1 UTSW 12 65,013,118 (GRCm39) missense probably damaging 1.00
R3125:Togaram1 UTSW 12 65,013,118 (GRCm39) missense probably damaging 1.00
R3693:Togaram1 UTSW 12 65,030,283 (GRCm39) missense probably benign 0.34
R3857:Togaram1 UTSW 12 65,027,633 (GRCm39) missense possibly damaging 0.64
R3870:Togaram1 UTSW 12 65,049,419 (GRCm39) missense probably benign 0.00
R3871:Togaram1 UTSW 12 65,049,419 (GRCm39) missense probably benign 0.00
R4398:Togaram1 UTSW 12 65,027,630 (GRCm39) missense probably benign
R4578:Togaram1 UTSW 12 65,067,100 (GRCm39) missense probably damaging 1.00
R4579:Togaram1 UTSW 12 65,014,681 (GRCm39) missense probably damaging 1.00
R4621:Togaram1 UTSW 12 65,029,224 (GRCm39) missense possibly damaging 0.87
R4623:Togaram1 UTSW 12 65,029,224 (GRCm39) missense possibly damaging 0.87
R4655:Togaram1 UTSW 12 65,013,894 (GRCm39) missense possibly damaging 0.91
R5080:Togaram1 UTSW 12 65,030,177 (GRCm39) missense probably benign 0.02
R5459:Togaram1 UTSW 12 65,014,510 (GRCm39) missense probably damaging 1.00
R5652:Togaram1 UTSW 12 65,063,424 (GRCm39) missense probably benign 0.13
R5857:Togaram1 UTSW 12 65,042,331 (GRCm39) missense possibly damaging 0.64
R5997:Togaram1 UTSW 12 65,042,312 (GRCm39) missense probably benign 0.00
R6090:Togaram1 UTSW 12 65,014,575 (GRCm39) missense probably benign 0.07
R6117:Togaram1 UTSW 12 65,014,261 (GRCm39) missense probably damaging 1.00
R6221:Togaram1 UTSW 12 65,013,320 (GRCm39) missense probably damaging 1.00
R6505:Togaram1 UTSW 12 65,013,364 (GRCm39) missense possibly damaging 0.78
R6545:Togaram1 UTSW 12 65,024,981 (GRCm39) missense possibly damaging 0.90
R6706:Togaram1 UTSW 12 65,049,383 (GRCm39) missense probably benign 0.16
R7041:Togaram1 UTSW 12 65,067,160 (GRCm39) missense possibly damaging 0.76
R7199:Togaram1 UTSW 12 65,042,292 (GRCm39) missense probably benign
R7284:Togaram1 UTSW 12 65,055,454 (GRCm39) missense probably benign 0.09
R7451:Togaram1 UTSW 12 65,043,749 (GRCm39) missense probably damaging 1.00
R7504:Togaram1 UTSW 12 65,039,391 (GRCm39) missense possibly damaging 0.79
R7560:Togaram1 UTSW 12 65,057,916 (GRCm39) missense possibly damaging 0.52
R7802:Togaram1 UTSW 12 65,013,758 (GRCm39) nonsense probably null
R7842:Togaram1 UTSW 12 65,013,233 (GRCm39) missense probably damaging 1.00
R7922:Togaram1 UTSW 12 65,014,512 (GRCm39) missense probably damaging 1.00
R8174:Togaram1 UTSW 12 65,029,465 (GRCm39) missense possibly damaging 0.86
R8190:Togaram1 UTSW 12 65,053,686 (GRCm39) missense probably damaging 1.00
R8466:Togaram1 UTSW 12 65,033,216 (GRCm39) missense probably benign 0.00
R8523:Togaram1 UTSW 12 65,067,088 (GRCm39) missense probably damaging 1.00
R8861:Togaram1 UTSW 12 65,027,406 (GRCm39) missense possibly damaging 0.88
R9213:Togaram1 UTSW 12 65,065,906 (GRCm39) missense possibly damaging 0.60
R9381:Togaram1 UTSW 12 65,014,204 (GRCm39) missense probably damaging 1.00
R9396:Togaram1 UTSW 12 65,014,429 (GRCm39) missense probably damaging 0.99
R9645:Togaram1 UTSW 12 65,066,082 (GRCm39) nonsense probably null
R9784:Togaram1 UTSW 12 65,014,168 (GRCm39) nonsense probably null
X0021:Togaram1 UTSW 12 65,012,958 (GRCm39) missense probably benign 0.00
Z1177:Togaram1 UTSW 12 65,012,982 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- ACCACTATCTTCTTGTCTGATTAGG -3'
(R):5'- TGCAGGAACACATAGACAAGTTC -3'

Sequencing Primer
(F):5'- CATGTGTTTGACAGTGCATT -3'
(R):5'- TTAATCCCAGCACTTGGTAGGCAG -3'
Posted On 2020-07-28