Incidental Mutation 'R8264:H2-Aa'
ID 639750
Institutional Source Beutler Lab
Gene Symbol H2-Aa
Ensembl Gene ENSMUSG00000036594
Gene Name histocompatibility 2, class II antigen A, alpha
Synonyms Ia1, I-Aalpha, H-2Aa, A alpha, Aalpha, Ia-1
MMRRC Submission 067689-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8264 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34501718-34506797 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34506709 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 11 (V11A)
Ref Sequence ENSEMBL: ENSMUSP00000046105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040655] [ENSMUST00000174751]
AlphaFold no structure available at present
PDB Structure CRYSTAL STRUCTURE OF CLASS II MHC MOLECULE IAb BOUND TO EALPHA3K PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of murine class II MHC I-Ab in complex with a human CLIP peptide [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR B3K506 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR YAe62 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR 2W20 [X-RAY DIFFRACTION]
Crystal Structure of 809.B5 TCR complexed with MHC Class II I-Ab/3k peptide [X-RAY DIFFRACTION]
J809.B5 TCR bound to IAb/3K [X-RAY DIFFRACTION]
J809.B5 Y31A TCR bound to IAb3K [X-RAY DIFFRACTION]
14.C6 TCR complexed with MHC class II I-Ab/3K peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000040655
AA Change: V11A

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046105
Gene: ENSMUSG00000036594
AA Change: V11A

DomainStartEndE-ValueType
MHC_II_alpha 31 111 1.83e-45 SMART
IGc1 129 200 2.51e-27 SMART
Pfam:C1-set_C 203 255 2.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174751
AA Change: V11A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000133399
Gene: ENSMUSG00000036594
AA Change: V11A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc1 46 117 2.51e-27 SMART
low complexity region 141 158 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cell surface expression of MHC class II molecules on macrophages and show decreased CD4-positive T cell number, increased CD8-positive T cell number, thymus hyperplasia, enlarged lymph nodes, and altered splenocyte response to staphylococcal enterotoxin B. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,543 (GRCm39) C911S probably damaging Het
Abcc4 T A 14: 118,832,254 (GRCm39) N792I possibly damaging Het
Acacb A T 5: 114,345,427 (GRCm39) H960L probably benign Het
Aox1 A G 1: 58,092,873 (GRCm39) T162A possibly damaging Het
Cacna1g T C 11: 94,364,392 (GRCm39) S18G probably benign Het
Chfr T A 5: 110,300,300 (GRCm39) I348N possibly damaging Het
Cntln G A 4: 85,016,648 (GRCm39) R12Q probably damaging Het
Cyp2c40 A G 19: 39,795,971 (GRCm39) S136P possibly damaging Het
Dnah14 T A 1: 181,572,357 (GRCm39) M2896K probably damaging Het
Elp6 A G 9: 110,148,755 (GRCm39) T215A probably damaging Het
Esyt2 A C 12: 116,329,540 (GRCm39) Q699H probably benign Het
Fbxo25 A G 8: 13,979,393 (GRCm39) T204A possibly damaging Het
Fhdc1 A G 3: 84,362,339 (GRCm39) S294P probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Galnt10 A G 11: 57,673,032 (GRCm39) I463V probably benign Het
Glce A G 9: 61,967,712 (GRCm39) F480L probably benign Het
Hsd17b4 A G 18: 50,279,593 (GRCm39) T191A possibly damaging Het
Itpr3 G T 17: 27,323,086 (GRCm39) silent Het
Izumo4 G T 10: 80,538,572 (GRCm39) G8V Het
Klk1b5 T A 7: 43,869,454 (GRCm39) L178H probably damaging Het
Lama2 T C 10: 27,343,218 (GRCm39) N85D probably benign Het
Liph A C 16: 21,802,721 (GRCm39) I116R possibly damaging Het
Lpar5 T A 6: 125,058,465 (GRCm39) V62D probably damaging Het
Map3k19 T A 1: 127,751,528 (GRCm39) I303F Het
Mymk A G 2: 26,957,868 (GRCm39) probably benign Het
Myo10 G A 15: 25,800,195 (GRCm39) V1424M probably damaging Het
Myof T G 19: 37,909,881 (GRCm39) Q1528P probably damaging Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Nup214 T A 2: 31,884,738 (GRCm39) Y500N possibly damaging Het
Or5al6 T C 2: 85,976,538 (GRCm39) D180G probably damaging Het
Pappa2 T C 1: 158,682,543 (GRCm39) Y835C probably damaging Het
Pcdh18 T C 3: 49,711,030 (GRCm39) E95G probably damaging Het
Phf3 A T 1: 30,870,138 (GRCm39) N303K possibly damaging Het
Pnn C T 12: 59,119,363 (GRCm39) H649Y unknown Het
Rab11fip1 G A 8: 27,642,508 (GRCm39) Q764* probably null Het
Ralgapa2 A T 2: 146,175,370 (GRCm39) M1762K possibly damaging Het
Rif1 G A 2: 51,980,290 (GRCm39) A496T noncoding transcript Het
Rnase13 A T 14: 52,159,914 (GRCm39) V75D probably damaging Het
Sema3c G A 5: 17,881,537 (GRCm39) probably benign Het
Sema4c C G 1: 36,591,966 (GRCm39) G266R probably damaging Het
Slfn5 A T 11: 82,847,376 (GRCm39) D87V probably damaging Het
Smpd3 T C 8: 106,991,290 (GRCm39) Y421C probably damaging Het
Snrnp40 T C 4: 130,271,867 (GRCm39) V188A probably benign Het
Srms A G 2: 180,854,343 (GRCm39) Y75H probably benign Het
Tent2 C T 13: 93,312,077 (GRCm39) G208S probably damaging Het
Tex15 T C 8: 34,072,390 (GRCm39) S2646P probably benign Het
Togaram1 A G 12: 65,042,330 (GRCm39) I1130V probably benign Het
Ttf1 A G 2: 28,954,689 (GRCm39) K18E possibly damaging Het
Unc5b G T 10: 60,604,113 (GRCm39) T827K probably benign Het
Zfhx2 T A 14: 55,302,969 (GRCm39) T1672S possibly damaging Het
Other mutations in H2-Aa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:H2-Aa APN 17 34,503,504 (GRCm39) missense probably damaging 1.00
citation UTSW 17 34,506,651 (GRCm39) splice site probably null
reference UTSW 17 34,502,794 (GRCm39) missense probably damaging 1.00
G1citation:H2-Aa UTSW 17 34,506,651 (GRCm39) splice site probably null
R1556:H2-Aa UTSW 17 34,503,390 (GRCm39) missense possibly damaging 0.94
R1901:H2-Aa UTSW 17 34,502,207 (GRCm39) missense possibly damaging 0.65
R2144:H2-Aa UTSW 17 34,502,801 (GRCm39) missense probably damaging 1.00
R4816:H2-Aa UTSW 17 34,502,794 (GRCm39) missense probably damaging 1.00
R5607:H2-Aa UTSW 17 34,502,816 (GRCm39) missense possibly damaging 0.89
R5608:H2-Aa UTSW 17 34,502,816 (GRCm39) missense possibly damaging 0.89
R6264:H2-Aa UTSW 17 34,502,172 (GRCm39) missense probably damaging 0.98
R6822:H2-Aa UTSW 17 34,506,651 (GRCm39) splice site probably null
R6917:H2-Aa UTSW 17 34,502,681 (GRCm39) missense probably damaging 1.00
R7052:H2-Aa UTSW 17 34,503,484 (GRCm39) missense possibly damaging 0.50
R7116:H2-Aa UTSW 17 34,502,601 (GRCm39) nonsense probably null
R8168:H2-Aa UTSW 17 34,506,695 (GRCm39) missense possibly damaging 0.83
R8257:H2-Aa UTSW 17 34,502,211 (GRCm39) missense probably damaging 0.97
R8682:H2-Aa UTSW 17 34,502,734 (GRCm39) missense possibly damaging 0.75
R9667:H2-Aa UTSW 17 34,502,295 (GRCm39) missense probably benign
X0063:H2-Aa UTSW 17 34,506,785 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTGGATTGTGAGCTGACCAAC -3'
(R):5'- TCTTCCAGGCCTCCTAATACAAAG -3'

Sequencing Primer
(F):5'- CCAGAGCCTCCTGAAGAATGG -3'
(R):5'- TACAAAGTCTGCAGCTGGC -3'
Posted On 2020-07-28