Mutagenetix > Incidental Mutation

Incidental Mutation 'R8264:Hsd17b4'

639751

Institutional Source

Beutler Lab

Gene Symbol

Hsd17b4

Ensembl Gene

ENSMUSG00000024507

Gene Name

hydroxysteroid (17-beta) dehydrogenase 4

Synonyms

D-bifunctional protein, MFP2, multifunctional protein 2, 17[b]-HSD, Mfp-2, perMFE-2, MFE-2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.522) question?

Stock #

R8264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

50128201-50196269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50146526 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 191 (T191A)

Ref Sequence

ENSEMBL: ENSMUSP00000025385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025385]

AlphaFold

P51660

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025385
AA Change: T191A

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000025385
Gene: ENSMUSG00000024507
AA Change: T191A

Domain	Start	End	E-Value	Type
Pfam:KR	10	186	2.1e-17	PFAM
Pfam:adh_short	10	208	2.3e-39	PFAM
Pfam:MaoC_dehydrat_N	346	451	1.4e-8	PFAM
low complexity region	458	470	N/A	INTRINSIC
Pfam:MaoC_dehydratas	479	600	1.8e-41	PFAM
Pfam:SCP2	627	730	8.4e-27	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in fatty acid metabolism, retarded growth, abnormal bile salt composition, impaired coordination, demyelination and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,782	C911S	probably damaging	Het
Abcc4	T	A	14: 118,594,842	N792I	possibly damaging	Het
Acacb	A	T	5: 114,207,366	H960L	probably benign	Het
Aox1	A	G	1: 58,053,714	T162A	possibly damaging	Het
Cacna1g	T	C	11: 94,473,566	S18G	probably benign	Het
Chfr	T	A	5: 110,152,434	I348N	possibly damaging	Het
Cntln	G	A	4: 85,098,411	R12Q	probably damaging	Het
Cyp2c40	A	G	19: 39,807,527	S136P	possibly damaging	Het
Dnah14	T	A	1: 181,744,792	M2896K	probably damaging	Het
Elp6	A	G	9: 110,319,687	T215A	probably damaging	Het
Esyt2	A	C	12: 116,365,920	Q699H	probably benign	Het
Fbxo25	A	G	8: 13,929,393	T204A	possibly damaging	Het
Fhdc1	A	G	3: 84,455,032	S294P	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Galnt10	A	G	11: 57,782,206	I463V	probably benign	Het
Glce	A	G	9: 62,060,430	F480L	probably benign	Het
H2-Aa	A	G	17: 34,287,735	V11A	probably benign	Het
Itpr3	G	T	17: 27,104,112		silent	Het
Izumo4	G	T	10: 80,702,738	G8V		Het
Klk1b5	T	A	7: 44,220,030	L178H	probably damaging	Het
Lama2	T	C	10: 27,467,222	N85D	probably benign	Het
Liph	A	C	16: 21,983,971	I116R	possibly damaging	Het
Lpar5	T	A	6: 125,081,502	V62D	probably damaging	Het
Map3k19	T	A	1: 127,823,791	I303F		Het
Mymk	A	G	2: 27,067,856		probably benign	Het
Myo10	G	A	15: 25,800,109	V1424M	probably damaging	Het
Myof	T	G	19: 37,921,433	Q1528P	probably damaging	Het
Ncapd3	T	C	9: 27,094,742		probably benign	Het
Nup214	T	A	2: 31,994,726	Y500N	possibly damaging	Het
Olfr1040	T	C	2: 86,146,194	D180G	probably damaging	Het
Papd4	C	T	13: 93,175,569	G208S	probably damaging	Het
Pappa2	T	C	1: 158,854,973	Y835C	probably damaging	Het
Pcdh18	T	C	3: 49,756,581	E95G	probably damaging	Het
Phf3	A	T	1: 30,831,057	N303K	possibly damaging	Het
Pnn	C	T	12: 59,072,577	H649Y	unknown	Het
Rab11fip1	G	A	8: 27,152,480	Q764*	probably null	Het
Ralgapa2	A	T	2: 146,333,450	M1762K	possibly damaging	Het
Rif1	G	A	2: 52,090,278	A496T	noncoding transcript	Het
Rnase13	A	T	14: 51,922,457	V75D	probably damaging	Het
Sema3c	G	A	5: 17,676,539		probably benign	Het
Sema4c	C	G	1: 36,552,885	G266R	probably damaging	Het
Slfn5	A	T	11: 82,956,550	D87V	probably damaging	Het
Smpd3	T	C	8: 106,264,658	Y421C	probably damaging	Het
Snrnp40	T	C	4: 130,378,074	V188A	probably benign	Het
Srms	A	G	2: 181,212,550	Y75H	probably benign	Het
Tex15	T	C	8: 33,582,362	S2646P	probably benign	Het
Togaram1	A	G	12: 64,995,556	I1130V	probably benign	Het
Ttf1	A	G	2: 29,064,677	K18E	possibly damaging	Het
Unc5b	G	T	10: 60,768,334	T827K	probably benign	Het
Zfhx2	T	A	14: 55,065,512	T1672S	possibly damaging	Het

Other mutations in Hsd17b4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00646:Hsd17b4	APN	18	50164845	missense	probably benign
IGL01369:Hsd17b4	APN	18	50172033	missense	possibly damaging	0.95
IGL01411:Hsd17b4	APN	18	50191814	missense	probably damaging	1.00
IGL01986:Hsd17b4	APN	18	50160126	splice site	probably benign
IGL02126:Hsd17b4	APN	18	50181996	missense	probably benign
IGL02496:Hsd17b4	APN	18	50155153	missense	probably damaging	0.97
IGL02527:Hsd17b4	APN	18	50160164	missense	probably benign	0.00
IGL02553:Hsd17b4	APN	18	50162097	splice site	probably benign
IGL02813:Hsd17b4	APN	18	50128348	utr 5 prime	probably benign
inauspicious	UTSW	18	50146424	missense	probably damaging	1.00
I0000:Hsd17b4	UTSW	18	50160228	missense	probably benign	0.09
IGL02980:Hsd17b4	UTSW	18	50146518	missense	probably benign	0.06
R0352:Hsd17b4	UTSW	18	50191784	missense	probably benign
R0734:Hsd17b4	UTSW	18	50170777	missense	possibly damaging	0.90
R0967:Hsd17b4	UTSW	18	50183261	missense	probably benign	0.00
R1418:Hsd17b4	UTSW	18	50130187	splice site	probably benign
R1661:Hsd17b4	UTSW	18	50160215	missense	probably benign
R1665:Hsd17b4	UTSW	18	50160215	missense	probably benign
R1752:Hsd17b4	UTSW	18	50170767	missense	probably benign	0.27
R1804:Hsd17b4	UTSW	18	50177984	missense	probably damaging	1.00
R2197:Hsd17b4	UTSW	18	50183302	splice site	probably null
R4351:Hsd17b4	UTSW	18	50142634	missense	probably damaging	1.00
R4405:Hsd17b4	UTSW	18	50128314	start gained	probably benign
R4976:Hsd17b4	UTSW	18	50160135	missense	probably damaging	1.00
R5788:Hsd17b4	UTSW	18	50173709	missense	probably damaging	0.99
R5826:Hsd17b4	UTSW	18	50183172	missense	probably benign	0.00
R5889:Hsd17b4	UTSW	18	50177209	missense	probably damaging	1.00
R6475:Hsd17b4	UTSW	18	50172262	splice site	probably null
R6632:Hsd17b4	UTSW	18	50179102	missense	possibly damaging	0.70
R7151:Hsd17b4	UTSW	18	50128370	missense	probably damaging	1.00
R7367:Hsd17b4	UTSW	18	50155185	missense	probably damaging	1.00
R7383:Hsd17b4	UTSW	18	50164850	missense	probably benign	0.13
R7397:Hsd17b4	UTSW	18	50146424	missense	probably damaging	1.00
R7509:Hsd17b4	UTSW	18	50164682	missense	probably damaging	1.00
R7697:Hsd17b4	UTSW	18	50130141	missense	probably damaging	1.00
R7722:Hsd17b4	UTSW	18	50146524	missense	probably damaging	1.00
R7764:Hsd17b4	UTSW	18	50146415	nonsense	probably null
R8065:Hsd17b4	UTSW	18	50170752	missense	possibly damaging	0.90
R8350:Hsd17b4	UTSW	18	50164667	missense	probably benign	0.00
R8450:Hsd17b4	UTSW	18	50164667	missense	probably benign	0.00
R9345:Hsd17b4	UTSW	18	50166914	missense	probably benign	0.04
R9654:Hsd17b4	UTSW	18	50139466	missense	probably benign	0.01
R9705:Hsd17b4	UTSW	18	50191724	missense	probably benign	0.41
R9790:Hsd17b4	UTSW	18	50191840	critical splice donor site	probably null
R9791:Hsd17b4	UTSW	18	50191840	critical splice donor site	probably null
Z1177:Hsd17b4	UTSW	18	50181980	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CACAGGCAGAGATGATGCTG -3'
(R):5'- ACAGTGTGACAGACTCTAACAC -3'

Sequencing Primer
(F):5'- GCAGAGATGATGCTGGTGTTG -3'
(R):5'- TGTGGCAGGCTCTAACACACTC -3'

Posted On

2020-07-28