Incidental Mutation 'R8263:Etl4'
ID 639758
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Name enhancer trap locus 4
Synonyms 6620402G01Rik, Sickle tail, E330027G05Rik, Etl-4, Skt, 9430077C05Rik
MMRRC Submission 067688-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.809) question?
Stock # R8263 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 19915018-20815346 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20748965 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 434 (E434D)
Ref Sequence ENSEMBL: ENSMUSP00000110257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114606] [ENSMUST00000114607] [ENSMUST00000114608] [ENSMUST00000114610] [ENSMUST00000114614] [ENSMUST00000114627]
AlphaFold A2AQ25
Predicted Effect probably benign
Transcript: ENSMUST00000045555
AA Change: E514D

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: E514D

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066509
AA Change: E514D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: E514D

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114604
AA Change: E514D

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: E514D

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114606
AA Change: E232D

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110253
Gene: ENSMUSG00000036617
AA Change: E232D

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114607
AA Change: E232D

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110254
Gene: ENSMUSG00000036617
AA Change: E232D

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114608
AA Change: E232D

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110255
Gene: ENSMUSG00000036617
AA Change: E232D

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 1055 1064 N/A INTRINSIC
low complexity region 1153 1178 N/A INTRINSIC
low complexity region 1254 1265 N/A INTRINSIC
coiled coil region 1341 1369 N/A INTRINSIC
low complexity region 1407 1420 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114610
AA Change: E434D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110257
Gene: ENSMUSG00000036617
AA Change: E434D

DomainStartEndE-ValueType
Pfam:AIP3 108 211 5e-12 PFAM
low complexity region 233 248 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114614
AA Change: E514D

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: E514D

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114627
AA Change: E565D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: E565D

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T A 1: 75,208,683 (GRCm39) R12S unknown Het
Ankrd10 C T 8: 11,665,707 (GRCm39) V298I probably benign Het
Atg4d T A 9: 21,178,335 (GRCm39) M151K probably damaging Het
Calhm5 C A 10: 33,972,192 (GRCm39) C81F probably damaging Het
Casp8ap2 T A 4: 32,644,072 (GRCm39) H1048Q probably damaging Het
Cd300ld2 A G 11: 114,903,192 (GRCm39) S218P unknown Het
Clec3a T C 8: 115,152,369 (GRCm39) V125A probably benign Het
Cnot6 A T 11: 49,573,002 (GRCm39) Y241N probably damaging Het
Dnah1 A T 14: 31,015,134 (GRCm39) F1686Y probably damaging Het
Dnah12 A G 14: 26,613,421 (GRCm39) K1285E noncoding transcript Het
Dop1b T C 16: 93,559,083 (GRCm39) S610P possibly damaging Het
Ehhadh A T 16: 21,592,295 (GRCm39) L136H probably damaging Het
Epha7 A G 4: 28,821,149 (GRCm39) T105A probably damaging Het
Fastkd2 T C 1: 63,770,968 (GRCm39) V108A probably benign Het
Fat2 G A 11: 55,174,962 (GRCm39) T1917I probably benign Het
Fbxo45 A G 16: 32,065,533 (GRCm39) S33P unknown Het
Fig4 A T 10: 41,143,711 (GRCm39) Y249* probably null Het
Fryl T C 5: 73,238,348 (GRCm39) Y1466C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Glod4 T C 11: 76,125,318 (GRCm39) D147G possibly damaging Het
Gm12695 T G 4: 96,651,046 (GRCm39) M136L probably benign Het
Gm5422 A G 10: 31,125,099 (GRCm39) T313A noncoding transcript Het
Hydin C A 8: 111,178,705 (GRCm39) A1100D probably benign Het
Ift172 G A 5: 31,422,681 (GRCm39) A923V possibly damaging Het
Irgc G A 7: 24,132,107 (GRCm39) H237Y probably damaging Het
Itga11 T C 9: 62,604,262 (GRCm39) I50T possibly damaging Het
Itpr3 C T 17: 27,334,887 (GRCm39) Q2134* probably null Het
Kat8 A T 7: 127,523,653 (GRCm39) D292V possibly damaging Het
Kdm2a A G 19: 4,374,392 (GRCm39) M913T possibly damaging Het
Larp4 T C 15: 99,883,961 (GRCm39) V66A probably benign Het
Loxhd1 A G 18: 77,462,858 (GRCm39) D899G probably damaging Het
Lrrc47 G T 4: 154,100,486 (GRCm39) R354L probably damaging Het
Lss C T 10: 76,367,739 (GRCm39) R24C probably damaging Het
Mmp14 C T 14: 54,673,244 (GRCm39) R51C probably damaging Het
Mon1a C T 9: 107,775,993 (GRCm39) T37I probably benign Het
Mtcl2 A G 2: 156,869,510 (GRCm39) W1042R possibly damaging Het
Nacc2 A C 2: 25,952,240 (GRCm39) V372G probably damaging Het
Ncapg T C 5: 45,849,134 (GRCm39) V690A probably benign Het
Nhej1 A G 1: 75,006,896 (GRCm39) L152P probably damaging Het
Nol4l A T 2: 153,259,337 (GRCm39) S522R probably damaging Het
Nr0b2 A G 4: 133,281,241 (GRCm39) Y169C probably damaging Het
Numa1 A G 7: 101,648,491 (GRCm39) M741V probably benign Het
Or10d1b A G 9: 39,613,453 (GRCm39) M204T possibly damaging Het
Or8g28 A G 9: 39,169,899 (GRCm39) L26P probably damaging Het
Pebp1 C A 5: 117,425,473 (GRCm39) probably null Het
Pik3ip1 A T 11: 3,291,581 (GRCm39) I217F probably damaging Het
Plekhg1 T A 10: 3,907,651 (GRCm39) I911N Het
Pnpla8 T C 12: 44,342,846 (GRCm39) I534T probably damaging Het
Ppp2r2a A T 14: 67,261,205 (GRCm39) F172I probably damaging Het
Rab7 C T 6: 87,989,292 (GRCm39) M59I probably benign Het
Rbm34 T C 8: 127,692,139 (GRCm39) N201S probably benign Het
Rfx1 G T 8: 84,821,483 (GRCm39) R764L probably damaging Het
Rnase12 T A 14: 51,294,580 (GRCm39) D33V probably damaging Het
Rnf121 A G 7: 101,684,532 (GRCm39) L127P probably damaging Het
Rtl1 C A 12: 109,560,180 (GRCm39) R553L probably damaging Het
Scn8a T C 15: 100,881,736 (GRCm39) L601P probably damaging Het
Scyl2 G T 10: 89,476,525 (GRCm39) Q867K possibly damaging Het
Sgtb T C 13: 104,268,692 (GRCm39) F213L probably benign Het
Slc35f4 A G 14: 49,551,084 (GRCm39) V260A probably damaging Het
Slfn14 A G 11: 83,174,299 (GRCm39) Y231H possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Stard13 G A 5: 151,157,106 (GRCm39) A25V possibly damaging Het
Stk38 C T 17: 29,203,161 (GRCm39) R135H probably damaging Het
Svil A G 18: 5,108,679 (GRCm39) D1939G probably damaging Het
Tasor2 C T 13: 3,625,286 (GRCm39) V1555I possibly damaging Het
Tasor2 G T 13: 3,640,016 (GRCm39) P374T probably benign Het
Tbc1d7 A G 13: 43,323,340 (GRCm39) V17A possibly damaging Het
Trpc4 T C 3: 54,129,756 (GRCm39) V174A probably damaging Het
Ttn G T 2: 76,619,028 (GRCm39) T16117K probably damaging Het
Tubb3 T A 8: 124,147,868 (GRCm39) M267K possibly damaging Het
Upk1b T C 16: 38,604,585 (GRCm39) T147A probably damaging Het
Vmn2r107 G T 17: 20,580,614 (GRCm39) C517F probably damaging Het
Vmn2r112 A G 17: 22,824,140 (GRCm39) D465G probably damaging Het
Vmn2r73 A T 7: 85,507,619 (GRCm39) H564Q probably benign Het
Vmn2r79 A G 7: 86,686,726 (GRCm39) I702M possibly damaging Het
Vmn2r84 A G 10: 130,227,037 (GRCm39) V267A probably damaging Het
Zfp445 T C 9: 122,681,878 (GRCm39) I688V probably benign Het
Zfp955a C T 17: 33,463,087 (GRCm39) V15M probably damaging Het
Zfp960 T A 17: 17,308,202 (GRCm39) C305* probably null Het
Zfp964 A G 8: 70,116,345 (GRCm39) D315G possibly damaging Het
Zmynd10 T A 9: 107,426,516 (GRCm39) I183K possibly damaging Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20,771,289 (GRCm39) missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20,534,865 (GRCm39) missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20,811,342 (GRCm39) nonsense probably null
IGL01099:Etl4 APN 2 20,811,922 (GRCm39) missense probably benign 0.06
IGL01337:Etl4 APN 2 20,790,198 (GRCm39) missense probably benign 0.01
IGL01348:Etl4 APN 2 20,811,784 (GRCm39) missense probably damaging 1.00
IGL01349:Etl4 APN 2 20,718,207 (GRCm39) missense probably damaging 1.00
IGL01407:Etl4 APN 2 20,748,667 (GRCm39) missense probably damaging 0.99
IGL01552:Etl4 APN 2 20,783,000 (GRCm39) missense probably damaging 0.99
IGL01662:Etl4 APN 2 20,811,460 (GRCm39) missense probably benign 0.04
IGL01687:Etl4 APN 2 20,534,898 (GRCm39) missense probably damaging 1.00
IGL01793:Etl4 APN 2 20,748,709 (GRCm39) missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20,811,493 (GRCm39) missense probably benign 0.06
IGL02025:Etl4 APN 2 20,811,337 (GRCm39) missense probably damaging 1.00
IGL02088:Etl4 APN 2 20,811,359 (GRCm39) missense probably damaging 1.00
IGL02134:Etl4 APN 2 20,811,240 (GRCm39) missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20,535,000 (GRCm39) missense probably damaging 1.00
IGL02480:Etl4 APN 2 20,793,335 (GRCm39) missense probably damaging 0.99
IGL02560:Etl4 APN 2 20,748,529 (GRCm39) missense probably damaging 1.00
IGL02851:Etl4 APN 2 20,812,840 (GRCm39) missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20,765,021 (GRCm39) splice site probably benign
IGL02951:Etl4 APN 2 20,806,348 (GRCm39) splice site probably benign
IGL03119:Etl4 APN 2 20,718,198 (GRCm39) missense probably damaging 1.00
IGL03267:Etl4 APN 2 20,789,993 (GRCm39) nonsense probably null
IGL03379:Etl4 APN 2 20,666,827 (GRCm39) missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20,748,385 (GRCm39) missense probably damaging 1.00
R0038:Etl4 UTSW 2 20,748,385 (GRCm39) missense probably damaging 1.00
R0095:Etl4 UTSW 2 20,748,679 (GRCm39) missense probably damaging 1.00
R0100:Etl4 UTSW 2 20,344,716 (GRCm39) missense probably benign
R0311:Etl4 UTSW 2 20,811,940 (GRCm39) missense probably damaging 1.00
R0346:Etl4 UTSW 2 20,764,463 (GRCm39) critical splice donor site probably null
R0348:Etl4 UTSW 2 20,782,940 (GRCm39) missense probably damaging 1.00
R0379:Etl4 UTSW 2 20,812,165 (GRCm39) missense probably damaging 0.98
R0571:Etl4 UTSW 2 20,748,580 (GRCm39) missense probably damaging 0.99
R0697:Etl4 UTSW 2 20,748,672 (GRCm39) missense probably damaging 1.00
R0707:Etl4 UTSW 2 20,810,382 (GRCm39) splice site probably benign
R0980:Etl4 UTSW 2 20,806,378 (GRCm39) missense probably damaging 1.00
R1120:Etl4 UTSW 2 20,811,514 (GRCm39) missense probably benign 0.00
R1254:Etl4 UTSW 2 20,812,734 (GRCm39) missense probably damaging 1.00
R1346:Etl4 UTSW 2 20,810,955 (GRCm39) missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20,793,288 (GRCm39) missense probably damaging 1.00
R1503:Etl4 UTSW 2 20,748,685 (GRCm39) missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20,790,039 (GRCm39) missense probably damaging 1.00
R1627:Etl4 UTSW 2 20,806,390 (GRCm39) missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20,811,219 (GRCm39) missense probably damaging 1.00
R1716:Etl4 UTSW 2 20,748,492 (GRCm39) missense probably damaging 1.00
R1795:Etl4 UTSW 2 20,812,837 (GRCm39) critical splice donor site probably null
R1885:Etl4 UTSW 2 20,748,795 (GRCm39) missense probably damaging 1.00
R2039:Etl4 UTSW 2 20,790,039 (GRCm39) missense probably damaging 1.00
R2083:Etl4 UTSW 2 20,748,360 (GRCm39) missense probably damaging 1.00
R2109:Etl4 UTSW 2 20,790,153 (GRCm39) missense probably benign 0.27
R2153:Etl4 UTSW 2 20,803,545 (GRCm39) missense probably benign 0.00
R2403:Etl4 UTSW 2 20,812,117 (GRCm39) nonsense probably null
R2883:Etl4 UTSW 2 20,810,985 (GRCm39) missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20,786,660 (GRCm39) missense probably damaging 1.00
R3402:Etl4 UTSW 2 20,786,693 (GRCm39) missense probably damaging 1.00
R3696:Etl4 UTSW 2 20,806,473 (GRCm39) critical splice donor site probably null
R3755:Etl4 UTSW 2 20,748,348 (GRCm39) missense probably benign 0.10
R3813:Etl4 UTSW 2 20,793,246 (GRCm39) missense probably damaging 1.00
R3829:Etl4 UTSW 2 20,790,232 (GRCm39) missense probably benign 0.07
R3887:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3888:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3889:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3958:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R3959:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R3960:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R4058:Etl4 UTSW 2 20,810,830 (GRCm39) missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20,814,030 (GRCm39) utr 3 prime probably benign
R4077:Etl4 UTSW 2 20,812,772 (GRCm39) missense probably damaging 1.00
R4078:Etl4 UTSW 2 20,812,772 (GRCm39) missense probably damaging 1.00
R4127:Etl4 UTSW 2 20,748,886 (GRCm39) missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20,786,694 (GRCm39) missense probably damaging 1.00
R4492:Etl4 UTSW 2 20,811,676 (GRCm39) missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20,666,709 (GRCm39) missense probably damaging 1.00
R4820:Etl4 UTSW 2 20,811,496 (GRCm39) missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20,811,738 (GRCm39) missense probably damaging 1.00
R4888:Etl4 UTSW 2 20,344,922 (GRCm39) critical splice donor site probably null
R4938:Etl4 UTSW 2 20,803,460 (GRCm39) missense probably benign 0.00
R4943:Etl4 UTSW 2 20,812,092 (GRCm39) missense probably benign 0.05
R5121:Etl4 UTSW 2 20,344,922 (GRCm39) critical splice donor site probably null
R5191:Etl4 UTSW 2 20,344,810 (GRCm39) missense probably damaging 0.99
R5198:Etl4 UTSW 2 20,718,198 (GRCm39) missense probably damaging 1.00
R5199:Etl4 UTSW 2 20,748,853 (GRCm39) missense probably damaging 1.00
R5470:Etl4 UTSW 2 20,534,791 (GRCm39) missense probably damaging 0.99
R5513:Etl4 UTSW 2 20,748,638 (GRCm39) missense probably damaging 1.00
R5620:Etl4 UTSW 2 20,535,037 (GRCm39) missense probably damaging 1.00
R5635:Etl4 UTSW 2 20,811,846 (GRCm39) missense probably damaging 1.00
R5641:Etl4 UTSW 2 20,811,273 (GRCm39) frame shift probably null
R5690:Etl4 UTSW 2 20,810,647 (GRCm39) missense probably benign 0.01
R5784:Etl4 UTSW 2 20,811,016 (GRCm39) missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20,811,323 (GRCm39) missense probably damaging 1.00
R5908:Etl4 UTSW 2 20,748,718 (GRCm39) missense probably damaging 0.96
R5982:Etl4 UTSW 2 20,785,826 (GRCm39) missense probably damaging 1.00
R6151:Etl4 UTSW 2 20,718,171 (GRCm39) missense probably damaging 1.00
R6192:Etl4 UTSW 2 20,806,362 (GRCm39) missense probably damaging 0.98
R6238:Etl4 UTSW 2 20,806,379 (GRCm39) missense probably damaging 1.00
R6248:Etl4 UTSW 2 20,813,900 (GRCm39) missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20,748,384 (GRCm39) missense probably damaging 1.00
R6610:Etl4 UTSW 2 20,718,180 (GRCm39) missense probably damaging 1.00
R6739:Etl4 UTSW 2 20,718,246 (GRCm39) missense probably damaging 1.00
R6846:Etl4 UTSW 2 20,748,919 (GRCm39) missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20,811,120 (GRCm39) missense probably benign 0.01
R6873:Etl4 UTSW 2 20,802,803 (GRCm39) splice site probably null
R7003:Etl4 UTSW 2 20,810,695 (GRCm39) missense probably benign 0.03
R7155:Etl4 UTSW 2 20,811,742 (GRCm39) missense probably damaging 0.96
R7207:Etl4 UTSW 2 20,714,387 (GRCm39) missense probably damaging 0.99
R7230:Etl4 UTSW 2 20,802,799 (GRCm39) missense probably damaging 1.00
R7305:Etl4 UTSW 2 20,714,368 (GRCm39) missense probably damaging 1.00
R7389:Etl4 UTSW 2 20,789,904 (GRCm39) nonsense probably null
R7396:Etl4 UTSW 2 20,803,449 (GRCm39) missense possibly damaging 0.62
R7441:Etl4 UTSW 2 20,749,000 (GRCm39) missense possibly damaging 0.87
R7626:Etl4 UTSW 2 20,718,189 (GRCm39) missense probably damaging 1.00
R7776:Etl4 UTSW 2 20,811,957 (GRCm39) missense probably damaging 0.99
R7779:Etl4 UTSW 2 20,714,288 (GRCm39) missense probably damaging 1.00
R7798:Etl4 UTSW 2 20,786,757 (GRCm39) critical splice donor site probably null
R7851:Etl4 UTSW 2 20,748,951 (GRCm39) missense probably damaging 1.00
R7861:Etl4 UTSW 2 20,810,721 (GRCm39) missense probably benign
R7901:Etl4 UTSW 2 20,294,821 (GRCm39) missense possibly damaging 0.83
R8053:Etl4 UTSW 2 20,666,774 (GRCm39) missense probably damaging 1.00
R8124:Etl4 UTSW 2 20,811,451 (GRCm39) missense probably benign 0.06
R8133:Etl4 UTSW 2 20,811,082 (GRCm39) missense possibly damaging 0.86
R8203:Etl4 UTSW 2 20,789,916 (GRCm39) missense possibly damaging 0.61
R8238:Etl4 UTSW 2 20,811,342 (GRCm39) nonsense probably null
R8299:Etl4 UTSW 2 20,748,874 (GRCm39) missense possibly damaging 0.81
R8318:Etl4 UTSW 2 20,793,341 (GRCm39) missense probably damaging 1.00
R8334:Etl4 UTSW 2 20,785,857 (GRCm39) missense probably damaging 0.96
R8443:Etl4 UTSW 2 20,810,977 (GRCm39) missense probably benign 0.04
R8525:Etl4 UTSW 2 20,534,892 (GRCm39) missense probably damaging 1.00
R8679:Etl4 UTSW 2 20,714,288 (GRCm39) missense probably damaging 1.00
R8918:Etl4 UTSW 2 20,811,246 (GRCm39) missense probably benign 0.00
R8918:Etl4 UTSW 2 20,748,733 (GRCm39) missense probably benign
R9062:Etl4 UTSW 2 20,748,616 (GRCm39) missense probably damaging 0.99
R9095:Etl4 UTSW 2 20,782,964 (GRCm39) missense probably damaging 1.00
R9200:Etl4 UTSW 2 20,786,702 (GRCm39) missense probably damaging 1.00
R9416:Etl4 UTSW 2 20,748,784 (GRCm39) missense probably benign 0.17
R9437:Etl4 UTSW 2 20,813,872 (GRCm39) missense probably benign 0.20
R9451:Etl4 UTSW 2 20,813,926 (GRCm39) missense probably benign 0.03
R9489:Etl4 UTSW 2 20,771,345 (GRCm39) missense possibly damaging 0.75
R9531:Etl4 UTSW 2 20,294,818 (GRCm39) start codon destroyed probably null 0.01
R9605:Etl4 UTSW 2 20,771,345 (GRCm39) missense possibly damaging 0.75
R9623:Etl4 UTSW 2 20,811,052 (GRCm39) missense
R9631:Etl4 UTSW 2 20,666,749 (GRCm39) missense probably benign 0.28
R9632:Etl4 UTSW 2 20,666,749 (GRCm39) missense probably benign 0.28
R9646:Etl4 UTSW 2 20,802,724 (GRCm39) missense probably benign 0.00
R9732:Etl4 UTSW 2 20,748,373 (GRCm39) missense probably damaging 0.98
R9755:Etl4 UTSW 2 20,790,048 (GRCm39) missense probably benign 0.17
R9771:Etl4 UTSW 2 20,811,537 (GRCm39) missense probably benign
RF003:Etl4 UTSW 2 20,524,729 (GRCm39) nonsense probably null
X0018:Etl4 UTSW 2 20,814,001 (GRCm39) missense probably damaging 0.98
X0022:Etl4 UTSW 2 20,714,375 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCCTTGCAAGCAGAAATGC -3'
(R):5'- GCTTTCAGCAACACACCAGG -3'

Sequencing Primer
(F):5'- TGCATATGGAGCAGTCGTTATACAG -3'
(R):5'- GGACAAACCATCCTCAGCC -3'
Posted On 2020-07-28