Incidental Mutation 'R0076:Galntl5'
ID63978
Institutional Source Beutler Lab
Gene Symbol Galntl5
Ensembl Gene ENSMUSG00000028938
Gene NameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Synonyms1700021B12Rik
MMRRC Submission 038363-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0076 (G1)
Quality Score107
Status Validated
Chromosome5
Chromosomal Location25181460-25220297 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 25186072 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030778] [ENSMUST00000114965]
Predicted Effect probably null
Transcript: ENSMUST00000030778
SMART Domains Protein: ENSMUSP00000030778
Gene: ENSMUSG00000028938

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 365 4.1e-10 PFAM
Pfam:Glycos_transf_2 118 304 4.2e-30 PFAM
Pfam:Glyco_tranf_2_2 118 383 1.7e-7 PFAM
Pfam:Glyco_transf_7C 277 349 2.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114965
SMART Domains Protein: ENSMUSP00000110616
Gene: ENSMUSG00000028938

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 82 332 1.8e-10 PFAM
Pfam:Glycos_transf_2 85 271 3.3e-28 PFAM
Pfam:Glyco_tranf_2_2 85 350 8.1e-8 PFAM
Pfam:Glyco_transf_7C 244 316 2.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158217
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Male heterozygous mice for this allele were infertile due to decreased sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,324,218 probably benign Het
Ankrd17 T A 5: 90,244,406 K1693* probably null Het
Car10 G A 11: 93,490,597 E129K possibly damaging Het
Ccnd1 A C 7: 144,939,665 V10G probably benign Het
Cd19 T C 7: 126,410,862 D406G probably damaging Het
Col4a1 G A 8: 11,218,713 P1009L probably damaging Het
Col9a1 G A 1: 24,237,497 probably null Het
Crlf3 A T 11: 80,056,601 probably benign Het
Dock3 A C 9: 106,911,486 probably benign Het
Dus1l A T 11: 120,792,808 probably benign Het
Dvl2 G A 11: 70,008,100 E438K probably damaging Het
Eif3g A G 9: 20,897,753 F85S probably damaging Het
Fam234b A G 6: 135,227,226 M456V probably benign Het
Fbxo47 G A 11: 97,857,655 probably benign Het
Gm11437 T C 11: 84,148,636 T288A possibly damaging Het
Gm5546 T A 3: 104,353,132 noncoding transcript Het
Gmfb C A 14: 46,817,455 A11S probably benign Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Ing3 T C 6: 21,952,171 M48T probably benign Het
Kmt2a A G 9: 44,830,059 probably benign Het
Maats1 G A 16: 38,302,684 Q661* probably null Het
Megf8 G A 7: 25,353,958 probably null Het
Pex3 A G 10: 13,535,594 V180A probably benign Het
Pou6f1 G A 15: 100,587,836 Q106* probably null Het
Ror2 T C 13: 53,113,074 M442V probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec1 A G 7: 45,678,891 V244A probably damaging Het
Serac1 A G 17: 6,064,937 probably benign Het
Sgcz A G 8: 37,545,442 probably benign Het
Slc16a7 A T 10: 125,228,070 V466D probably benign Het
Tbl1xr1 T A 3: 22,189,785 D74E probably benign Het
Ube3b G T 5: 114,408,217 probably null Het
Ugt2b37 A G 5: 87,254,221 S184P probably benign Het
Other mutations in Galntl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Galntl5 APN 5 25195351 missense probably damaging 1.00
IGL01637:Galntl5 APN 5 25189825 splice site probably benign
IGL02126:Galntl5 APN 5 25189841 missense possibly damaging 0.75
IGL02136:Galntl5 APN 5 25220062 missense probably benign 0.16
IGL02836:Galntl5 APN 5 25186239 missense probably benign
R0411:Galntl5 UTSW 5 25220174 missense probably benign 0.20
R1376:Galntl5 UTSW 5 25186288 missense probably benign 0.16
R1376:Galntl5 UTSW 5 25186288 missense probably benign 0.16
R1686:Galntl5 UTSW 5 25210434 missense probably benign 0.16
R1724:Galntl5 UTSW 5 25220122 missense possibly damaging 0.94
R1899:Galntl5 UTSW 5 25198532 nonsense probably null
R2213:Galntl5 UTSW 5 25217529 missense probably benign 0.13
R2215:Galntl5 UTSW 5 25198478 missense probably damaging 1.00
R2425:Galntl5 UTSW 5 25220081 missense probably damaging 0.99
R3811:Galntl5 UTSW 5 25186180 missense probably benign 0.19
R3812:Galntl5 UTSW 5 25186180 missense probably benign 0.19
R4072:Galntl5 UTSW 5 25198480 nonsense probably null
R4660:Galntl5 UTSW 5 25203379 missense probably damaging 1.00
R5792:Galntl5 UTSW 5 25198463 missense possibly damaging 0.59
R5844:Galntl5 UTSW 5 25186093 intron probably benign
R6267:Galntl5 UTSW 5 25186165 missense probably benign
R6296:Galntl5 UTSW 5 25186165 missense probably benign
R6896:Galntl5 UTSW 5 25189949 critical splice donor site probably null
R7138:Galntl5 UTSW 5 25189844 missense probably benign 0.13
R7256:Galntl5 UTSW 5 25195300 missense probably benign 0.00
Z1176:Galntl5 UTSW 5 25203189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCACAGACTCACTTGCGCTC -3'
(R):5'- CAGGTTCATCTGCATCCGACTTACC -3'

Sequencing Primer
(F):5'- GCAAGGACTTTAAATTATGCTGCC -3'
(R):5'- GCATCCGACTTACCATGAGTG -3'
Posted On2013-08-06