Incidental Mutation 'R8263:Itga11'
ID639791
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R8263 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62696980 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 50 (I50T)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034774
AA Change: I50T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: I50T

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T A 1: 75,232,039 R12S unknown Het
Ankrd10 C T 8: 11,615,707 V298I probably benign Het
Atg4d T A 9: 21,267,039 M151K probably damaging Het
Casp8ap2 T A 4: 32,644,072 H1048Q probably damaging Het
Cd300ld2 A G 11: 115,012,366 S218P unknown Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Cnot6 A T 11: 49,682,175 Y241N probably damaging Het
Dnah1 A T 14: 31,293,177 F1686Y probably damaging Het
Dnah12 A G 14: 26,891,464 K1285E noncoding transcript Het
Dopey2 T C 16: 93,762,195 S610P possibly damaging Het
Ehhadh A T 16: 21,773,545 L136H probably damaging Het
Epha7 A G 4: 28,821,149 T105A probably damaging Het
Etl4 A T 2: 20,744,154 E434D probably benign Het
Fam208b C T 13: 3,575,286 V1555I possibly damaging Het
Fam208b G T 13: 3,590,016 P374T probably benign Het
Fam26e C A 10: 34,096,196 C81F probably damaging Het
Fastkd2 T C 1: 63,731,809 V108A probably benign Het
Fat2 G A 11: 55,284,136 T1917I probably benign Het
Fbxo45 A G 16: 32,246,715 S33P unknown Het
Fig4 A T 10: 41,267,715 Y249* probably null Het
Fryl T C 5: 73,081,005 Y1466C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Glod4 T C 11: 76,234,492 D147G possibly damaging Het
Gm12695 T G 4: 96,762,809 M136L probably benign Het
Gm5422 A G 10: 31,249,103 T313A noncoding transcript Het
Hydin C A 8: 110,452,073 A1100D probably benign Het
Ift172 G A 5: 31,265,337 A923V possibly damaging Het
Irgc1 G A 7: 24,432,682 H237Y probably damaging Het
Itpr3 C T 17: 27,115,913 Q2134* probably null Het
Kat8 A T 7: 127,924,481 D292V possibly damaging Het
Kdm2a A G 19: 4,324,364 M913T possibly damaging Het
Larp4 T C 15: 99,986,080 V66A probably benign Het
Loxhd1 A G 18: 77,375,162 D899G probably damaging Het
Lrrc47 G T 4: 154,016,029 R354L probably damaging Het
Lss C T 10: 76,531,905 R24C probably damaging Het
Mmp14 C T 14: 54,435,787 R51C probably damaging Het
Mon1a C T 9: 107,898,794 T37I probably benign Het
Nacc2 A C 2: 26,062,228 V372G probably damaging Het
Ncapg T C 5: 45,691,792 V690A probably benign Het
Nhej1 A G 1: 74,967,737 L152P probably damaging Het
Nol4l A T 2: 153,417,417 S522R probably damaging Het
Nr0b2 A G 4: 133,553,930 Y169C probably damaging Het
Numa1 A G 7: 101,999,284 M741V probably benign Het
Olfr149 A G 9: 39,702,157 M204T possibly damaging Het
Olfr945 A G 9: 39,258,603 L26P probably damaging Het
Pebp1 C A 5: 117,287,408 probably null Het
Pik3ip1 A T 11: 3,341,581 I217F probably damaging Het
Plekhg1 T A 10: 3,957,651 I911N Het
Pnpla8 T C 12: 44,296,063 I534T probably damaging Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Rab7 C T 6: 88,012,310 M59I probably benign Het
Rbm34 T C 8: 126,965,389 N201S probably benign Het
Rfx1 G T 8: 84,094,854 R764L probably damaging Het
Rnase12 T A 14: 51,057,123 D33V probably damaging Het
Rnf121 A G 7: 102,035,325 L127P probably damaging Het
Rtl1 C A 12: 109,593,746 R553L probably damaging Het
Scn8a T C 15: 100,983,855 L601P probably damaging Het
Scyl2 G T 10: 89,640,663 Q867K possibly damaging Het
Sgtb T C 13: 104,132,184 F213L probably benign Het
Slc35f4 A G 14: 49,313,627 V260A probably damaging Het
Slfn14 A G 11: 83,283,473 Y231H possibly damaging Het
Soga1 A G 2: 157,027,590 W1042R possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stard13 G A 5: 151,233,641 A25V possibly damaging Het
Stk38 C T 17: 28,984,187 R135H probably damaging Het
Svil A G 18: 5,108,679 D1939G probably damaging Het
Tbc1d7 A G 13: 43,169,864 V17A possibly damaging Het
Trpc4 T C 3: 54,222,335 V174A probably damaging Het
Ttn G T 2: 76,788,684 T16117K probably damaging Het
Tubb3 T A 8: 123,421,129 M267K possibly damaging Het
Upk1b T C 16: 38,784,223 T147A probably damaging Het
Vmn2r107 G T 17: 20,360,352 C517F probably damaging Het
Vmn2r112 A G 17: 22,605,159 D465G probably damaging Het
Vmn2r73 A T 7: 85,858,411 H564Q probably benign Het
Vmn2r79 A G 7: 87,037,518 I702M possibly damaging Het
Vmn2r84 A G 10: 130,391,168 V267A probably damaging Het
Zfp445 T C 9: 122,852,813 I688V probably benign Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Zfp960 T A 17: 17,087,940 C305* probably null Het
Zfp964 A G 8: 69,663,695 D315G possibly damaging Het
Zmynd10 T A 9: 107,549,317 I183K possibly damaging Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
R7509:Itga11 UTSW 9 62781940 missense probably benign
R7601:Itga11 UTSW 9 62696926 missense probably benign 0.18
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
R8285:Itga11 UTSW 9 62752258 missense probably damaging 1.00
R8419:Itga11 UTSW 9 62755178 missense possibly damaging 0.59
R8422:Itga11 UTSW 9 62767678 missense probably benign 0.00
R8469:Itga11 UTSW 9 62771398 missense probably benign 0.00
R8475:Itga11 UTSW 9 62744045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGAGGCAGATGAGCAGC -3'
(R):5'- ACCCATTTCACAGATGGGAC -3'

Sequencing Primer
(F):5'- CCAGAGGGCCCAGACAC -3'
(R):5'- ACTGTAATTTGAGACCGCTGACC -3'
Posted On2020-07-28