Mutagenetix > Incidental Mutation

Incidental Mutation 'R8263:Fig4'

639798

Institutional Source

Beutler Lab

Gene Symbol

Fig4

Ensembl Gene

ENSMUSG00000038417

Gene Name

FIG4 phosphoinositide 5-phosphatase

Synonyms

A530089I17Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_133999.1; MGI:2143585

Essential gene?

Possibly non essential (E-score: 0.399) question?

Stock #

R8263 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41188172-41303260 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 41267715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 249 (Y249*)

Ref Sequence

ENSEMBL: ENSMUSP00000039598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043814]

AlphaFold

Q91WF7

Predicted Effect

probably null
Transcript: ENSMUST00000043814
AA Change: Y249*

SMART Domains

Protein: ENSMUSP00000039598
Gene: ENSMUSG00000038417
AA Change: Y249*

Domain	Start	End	E-Value	Type
Pfam:Syja_N	93	424	1.7e-79	PFAM
Blast:Lactamase_B	533	610	6e-21	BLAST
low complexity region	742	771	N/A	INTRINSIC
low complexity region	805	813	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

Strain: 3716838
Lethality: D30-D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, severe tremors, diluted coat color, neurodegeneration, impaired coordination, muscle weakness, small size and reduced spleen. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted(3) Gene trapped(12) Spontaneous(1)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630095N17Rik	T	A	1: 75,232,039	R12S	unknown	Het
Ankrd10	C	T	8: 11,615,707	V298I	probably benign	Het
Atg4d	T	A	9: 21,267,039	M151K	probably damaging	Het
Casp8ap2	T	A	4: 32,644,072	H1048Q	probably damaging	Het
Cd300ld2	A	G	11: 115,012,366	S218P	unknown	Het
Clec3a	T	C	8: 114,425,629	V125A	probably benign	Het
Cnot6	A	T	11: 49,682,175	Y241N	probably damaging	Het
Dnah1	A	T	14: 31,293,177	F1686Y	probably damaging	Het
Dnah12	A	G	14: 26,891,464	K1285E	noncoding transcript	Het
Dopey2	T	C	16: 93,762,195	S610P	possibly damaging	Het
Ehhadh	A	T	16: 21,773,545	L136H	probably damaging	Het
Epha7	A	G	4: 28,821,149	T105A	probably damaging	Het
Etl4	A	T	2: 20,744,154	E434D	probably benign	Het
Fam208b	C	T	13: 3,575,286	V1555I	possibly damaging	Het
Fam208b	G	T	13: 3,590,016	P374T	probably benign	Het
Fam26e	C	A	10: 34,096,196	C81F	probably damaging	Het
Fastkd2	T	C	1: 63,731,809	V108A	probably benign	Het
Fat2	G	A	11: 55,284,136	T1917I	probably benign	Het
Fbxo45	A	G	16: 32,246,715	S33P	unknown	Het
Fryl	T	C	5: 73,081,005	Y1466C	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Glod4	T	C	11: 76,234,492	D147G	possibly damaging	Het
Gm12695	T	G	4: 96,762,809	M136L	probably benign	Het
Gm5422	A	G	10: 31,249,103	T313A	noncoding transcript	Het
Hydin	C	A	8: 110,452,073	A1100D	probably benign	Het
Ift172	G	A	5: 31,265,337	A923V	possibly damaging	Het
Irgc1	G	A	7: 24,432,682	H237Y	probably damaging	Het
Itga11	T	C	9: 62,696,980	I50T	possibly damaging	Het
Itpr3	C	T	17: 27,115,913	Q2134*	probably null	Het
Kat8	A	T	7: 127,924,481	D292V	possibly damaging	Het
Kdm2a	A	G	19: 4,324,364	M913T	possibly damaging	Het
Larp4	T	C	15: 99,986,080	V66A	probably benign	Het
Loxhd1	A	G	18: 77,375,162	D899G	probably damaging	Het
Lrrc47	G	T	4: 154,016,029	R354L	probably damaging	Het
Lss	C	T	10: 76,531,905	R24C	probably damaging	Het
Mmp14	C	T	14: 54,435,787	R51C	probably damaging	Het
Mon1a	C	T	9: 107,898,794	T37I	probably benign	Het
Nacc2	A	C	2: 26,062,228	V372G	probably damaging	Het
Ncapg	T	C	5: 45,691,792	V690A	probably benign	Het
Nhej1	A	G	1: 74,967,737	L152P	probably damaging	Het
Nol4l	A	T	2: 153,417,417	S522R	probably damaging	Het
Nr0b2	A	G	4: 133,553,930	Y169C	probably damaging	Het
Numa1	A	G	7: 101,999,284	M741V	probably benign	Het
Olfr149	A	G	9: 39,702,157	M204T	possibly damaging	Het
Olfr945	A	G	9: 39,258,603	L26P	probably damaging	Het
Pebp1	C	A	5: 117,287,408		probably null	Het
Pik3ip1	A	T	11: 3,341,581	I217F	probably damaging	Het
Plekhg1	T	A	10: 3,957,651	I911N		Het
Pnpla8	T	C	12: 44,296,063	I534T	probably damaging	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Rab7	C	T	6: 88,012,310	M59I	probably benign	Het
Rbm34	T	C	8: 126,965,389	N201S	probably benign	Het
Rfx1	G	T	8: 84,094,854	R764L	probably damaging	Het
Rnase12	T	A	14: 51,057,123	D33V	probably damaging	Het
Rnf121	A	G	7: 102,035,325	L127P	probably damaging	Het
Rtl1	C	A	12: 109,593,746	R553L	probably damaging	Het
Scn8a	T	C	15: 100,983,855	L601P	probably damaging	Het
Scyl2	G	T	10: 89,640,663	Q867K	possibly damaging	Het
Sgtb	T	C	13: 104,132,184	F213L	probably benign	Het
Slc35f4	A	G	14: 49,313,627	V260A	probably damaging	Het
Slfn14	A	G	11: 83,283,473	Y231H	possibly damaging	Het
Soga1	A	G	2: 157,027,590	W1042R	possibly damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Stard13	G	A	5: 151,233,641	A25V	possibly damaging	Het
Stk38	C	T	17: 28,984,187	R135H	probably damaging	Het
Svil	A	G	18: 5,108,679	D1939G	probably damaging	Het
Tbc1d7	A	G	13: 43,169,864	V17A	possibly damaging	Het
Trpc4	T	C	3: 54,222,335	V174A	probably damaging	Het
Ttn	G	T	2: 76,788,684	T16117K	probably damaging	Het
Tubb3	T	A	8: 123,421,129	M267K	possibly damaging	Het
Upk1b	T	C	16: 38,784,223	T147A	probably damaging	Het
Vmn2r107	G	T	17: 20,360,352	C517F	probably damaging	Het
Vmn2r112	A	G	17: 22,605,159	D465G	probably damaging	Het
Vmn2r73	A	T	7: 85,858,411	H564Q	probably benign	Het
Vmn2r79	A	G	7: 87,037,518	I702M	possibly damaging	Het
Vmn2r84	A	G	10: 130,391,168	V267A	probably damaging	Het
Zfp445	T	C	9: 122,852,813	I688V	probably benign	Het
Zfp955a	C	T	17: 33,244,113	V15M	probably damaging	Het
Zfp960	T	A	17: 17,087,940	C305*	probably null	Het
Zfp964	A	G	8: 69,663,695	D315G	possibly damaging	Het
Zmynd10	T	A	9: 107,549,317	I183K	possibly damaging	Het

Other mutations in Fig4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Fig4	APN	10	41251788	missense	probably damaging	0.99
IGL01013:Fig4	APN	10	41267786	missense	probably benign	0.00
IGL01066:Fig4	APN	10	41285417	splice site	probably benign
IGL01501:Fig4	APN	10	41270374	missense	probably benign
IGL01503:Fig4	APN	10	41256518	missense	probably benign	0.00
IGL01535:Fig4	APN	10	41256494	missense	probably benign	0.00
IGL01733:Fig4	APN	10	41277393	missense	possibly damaging	0.49
IGL01782:Fig4	APN	10	41270400	missense	probably benign	0.18
IGL01866:Fig4	APN	10	41232164	missense	possibly damaging	0.77
IGL01934:Fig4	APN	10	41228112	missense	probably benign	0.03
IGL01966:Fig4	APN	10	41232102	splice site	probably null
IGL02032:Fig4	APN	10	41303006	missense	probably benign	0.00
IGL02225:Fig4	APN	10	41256452	missense	probably benign
IGL02345:Fig4	APN	10	41267774	missense	probably null	1.00
IGL02532:Fig4	APN	10	41285281	splice site	probably benign
IGL02686:Fig4	APN	10	41264004	missense	probably damaging	0.99
IGL02965:Fig4	APN	10	41285665	missense	probably damaging	0.98
P0021:Fig4	UTSW	10	41251825	missense	probably damaging	1.00
R0017:Fig4	UTSW	10	41273007	missense	possibly damaging	0.94
R0017:Fig4	UTSW	10	41273007	missense	possibly damaging	0.94
R0117:Fig4	UTSW	10	41230041	nonsense	probably null
R0144:Fig4	UTSW	10	41258049	missense	probably damaging	0.99
R0655:Fig4	UTSW	10	41285677	missense	probably damaging	1.00
R0701:Fig4	UTSW	10	41240512	nonsense	probably null
R0751:Fig4	UTSW	10	41272982	missense	probably damaging	1.00
R1540:Fig4	UTSW	10	41188586	missense	possibly damaging	0.60
R1586:Fig4	UTSW	10	41265427	missense	probably damaging	0.99
R2916:Fig4	UTSW	10	41258075	missense	probably damaging	0.98
R3927:Fig4	UTSW	10	41263139	missense	probably benign
R4304:Fig4	UTSW	10	41256427	missense	probably benign	0.01
R4586:Fig4	UTSW	10	41188632	missense	probably damaging	1.00
R4678:Fig4	UTSW	10	41272998	missense	probably benign	0.27
R4858:Fig4	UTSW	10	41233590	missense	probably benign	0.00
R5614:Fig4	UTSW	10	41272985	missense	probably damaging	0.98
R5896:Fig4	UTSW	10	41254885	missense	possibly damaging	0.67
R6126:Fig4	UTSW	10	41265447	missense	probably damaging	0.99
R7056:Fig4	UTSW	10	41220932	missense	probably benign	0.09
R7350:Fig4	UTSW	10	41251756	missense	probably benign	0.03
R7452:Fig4	UTSW	10	41240637	missense	possibly damaging	0.88
R7481:Fig4	UTSW	10	41230005	critical splice donor site	probably null
R7610:Fig4	UTSW	10	41253713	missense	probably damaging	1.00
R7818:Fig4	UTSW	10	41263166	missense	probably damaging	0.98
R7830:Fig4	UTSW	10	41256466	missense	probably benign	0.00
R8319:Fig4	UTSW	10	41263101	missense	probably damaging	1.00
R8409:Fig4	UTSW	10	41265431	missense	probably benign	0.01
R8435:Fig4	UTSW	10	41285674	missense	probably benign
R8474:Fig4	UTSW	10	41232174	missense	probably benign	0.30
R9086:Fig4	UTSW	10	41285403	missense	possibly damaging	0.50
R9131:Fig4	UTSW	10	41265411	missense	possibly damaging	0.95
R9248:Fig4	UTSW	10	41277482	missense	probably benign
R9401:Fig4	UTSW	10	41267737	missense	probably benign
R9564:Fig4	UTSW	10	41285391	missense	probably benign	0.20
R9627:Fig4	UTSW	10	41232182	missense	probably benign	0.01
R9649:Fig4	UTSW	10	41267767	missense	probably benign	0.00
Z1088:Fig4	UTSW	10	41253731	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCATGTAGCAGGAAAATGGC -3'
(R):5'- GCCTGCATCTGATCTTGAAGC -3'

Sequencing Primer
(F):5'- ATAAACCCATTGCTCCCAGTGTG -3'
(R):5'- CTGATCTTGAAGCAGAAGTGGAAG -3'

Posted On

2020-07-28