Incidental Mutation 'R8263:Sppl2b'
ID639800
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R8263 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80866069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T A 1: 75,232,039 R12S unknown Het
Ankrd10 C T 8: 11,615,707 V298I probably benign Het
Atg4d T A 9: 21,267,039 M151K probably damaging Het
Casp8ap2 T A 4: 32,644,072 H1048Q probably damaging Het
Cd300ld2 A G 11: 115,012,366 S218P unknown Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Cnot6 A T 11: 49,682,175 Y241N probably damaging Het
Dnah1 A T 14: 31,293,177 F1686Y probably damaging Het
Dnah12 A G 14: 26,891,464 K1285E noncoding transcript Het
Dopey2 T C 16: 93,762,195 S610P possibly damaging Het
Ehhadh A T 16: 21,773,545 L136H probably damaging Het
Epha7 A G 4: 28,821,149 T105A probably damaging Het
Etl4 A T 2: 20,744,154 E434D probably benign Het
Fam208b C T 13: 3,575,286 V1555I possibly damaging Het
Fam208b G T 13: 3,590,016 P374T probably benign Het
Fam26e C A 10: 34,096,196 C81F probably damaging Het
Fastkd2 T C 1: 63,731,809 V108A probably benign Het
Fat2 G A 11: 55,284,136 T1917I probably benign Het
Fbxo45 A G 16: 32,246,715 S33P unknown Het
Fig4 A T 10: 41,267,715 Y249* probably null Het
Fryl T C 5: 73,081,005 Y1466C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Glod4 T C 11: 76,234,492 D147G possibly damaging Het
Gm12695 T G 4: 96,762,809 M136L probably benign Het
Gm5422 A G 10: 31,249,103 T313A noncoding transcript Het
Hydin C A 8: 110,452,073 A1100D probably benign Het
Ift172 G A 5: 31,265,337 A923V possibly damaging Het
Irgc1 G A 7: 24,432,682 H237Y probably damaging Het
Itga11 T C 9: 62,696,980 I50T possibly damaging Het
Itpr3 C T 17: 27,115,913 Q2134* probably null Het
Kat8 A T 7: 127,924,481 D292V possibly damaging Het
Kdm2a A G 19: 4,324,364 M913T possibly damaging Het
Larp4 T C 15: 99,986,080 V66A probably benign Het
Loxhd1 A G 18: 77,375,162 D899G probably damaging Het
Lrrc47 G T 4: 154,016,029 R354L probably damaging Het
Lss C T 10: 76,531,905 R24C probably damaging Het
Mmp14 C T 14: 54,435,787 R51C probably damaging Het
Mon1a C T 9: 107,898,794 T37I probably benign Het
Nacc2 A C 2: 26,062,228 V372G probably damaging Het
Ncapg T C 5: 45,691,792 V690A probably benign Het
Nhej1 A G 1: 74,967,737 L152P probably damaging Het
Nol4l A T 2: 153,417,417 S522R probably damaging Het
Nr0b2 A G 4: 133,553,930 Y169C probably damaging Het
Numa1 A G 7: 101,999,284 M741V probably benign Het
Olfr149 A G 9: 39,702,157 M204T possibly damaging Het
Olfr945 A G 9: 39,258,603 L26P probably damaging Het
Pebp1 C A 5: 117,287,408 probably null Het
Pik3ip1 A T 11: 3,341,581 I217F probably damaging Het
Plekhg1 T A 10: 3,957,651 I911N Het
Pnpla8 T C 12: 44,296,063 I534T probably damaging Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Rab7 C T 6: 88,012,310 M59I probably benign Het
Rbm34 T C 8: 126,965,389 N201S probably benign Het
Rfx1 G T 8: 84,094,854 R764L probably damaging Het
Rnase12 T A 14: 51,057,123 D33V probably damaging Het
Rnf121 A G 7: 102,035,325 L127P probably damaging Het
Rtl1 C A 12: 109,593,746 R553L probably damaging Het
Scn8a T C 15: 100,983,855 L601P probably damaging Het
Scyl2 G T 10: 89,640,663 Q867K possibly damaging Het
Sgtb T C 13: 104,132,184 F213L probably benign Het
Slc35f4 A G 14: 49,313,627 V260A probably damaging Het
Slfn14 A G 11: 83,283,473 Y231H possibly damaging Het
Soga1 A G 2: 157,027,590 W1042R possibly damaging Het
Stard13 G A 5: 151,233,641 A25V possibly damaging Het
Stk38 C T 17: 28,984,187 R135H probably damaging Het
Svil A G 18: 5,108,679 D1939G probably damaging Het
Tbc1d7 A G 13: 43,169,864 V17A possibly damaging Het
Trpc4 T C 3: 54,222,335 V174A probably damaging Het
Ttn G T 2: 76,788,684 T16117K probably damaging Het
Tubb3 T A 8: 123,421,129 M267K possibly damaging Het
Upk1b T C 16: 38,784,223 T147A probably damaging Het
Vmn2r107 G T 17: 20,360,352 C517F probably damaging Het
Vmn2r112 A G 17: 22,605,159 D465G probably damaging Het
Vmn2r73 A T 7: 85,858,411 H564Q probably benign Het
Vmn2r79 A G 7: 87,037,518 I702M possibly damaging Het
Vmn2r84 A G 10: 130,391,168 V267A probably damaging Het
Zfp445 T C 9: 122,852,813 I688V probably benign Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Zfp960 T A 17: 17,087,940 C305* probably null Het
Zfp964 A G 8: 69,663,695 D315G possibly damaging Het
Zmynd10 T A 9: 107,549,317 I183K possibly damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R4350:Sppl2b UTSW 10 80862726 missense probably benign 0.12
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8212:Sppl2b UTSW 10 80865359 missense probably damaging 1.00
R8265:Sppl2b UTSW 10 80866069 frame shift probably null
R8367:Sppl2b UTSW 10 80863191 missense probably benign 0.02
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8398:Sppl2b UTSW 10 80866069 frame shift probably null
R8400:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8481:Sppl2b UTSW 10 80866069 frame shift probably null
R8505:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8818:Sppl2b UTSW 10 80866069 frame shift probably null
R8832:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGTGCATGCCCATTGTCAC -3'
(R):5'- TGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On2020-07-28