Incidental Mutation 'R8263:Sppl2b'
ID 639800
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Name signal peptide peptidase like 2B
Synonyms 3110056O03Rik
MMRRC Submission 067688-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R8263 (G1)
Quality Score 217.468
Status Not validated
Chromosome 10
Chromosomal Location 80691109-80704542 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80701903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
AlphaFold Q3TD49
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T A 1: 75,208,683 (GRCm39) R12S unknown Het
Ankrd10 C T 8: 11,665,707 (GRCm39) V298I probably benign Het
Atg4d T A 9: 21,178,335 (GRCm39) M151K probably damaging Het
Calhm5 C A 10: 33,972,192 (GRCm39) C81F probably damaging Het
Casp8ap2 T A 4: 32,644,072 (GRCm39) H1048Q probably damaging Het
Cd300ld2 A G 11: 114,903,192 (GRCm39) S218P unknown Het
Clec3a T C 8: 115,152,369 (GRCm39) V125A probably benign Het
Cnot6 A T 11: 49,573,002 (GRCm39) Y241N probably damaging Het
Dnah1 A T 14: 31,015,134 (GRCm39) F1686Y probably damaging Het
Dnah12 A G 14: 26,613,421 (GRCm39) K1285E noncoding transcript Het
Dop1b T C 16: 93,559,083 (GRCm39) S610P possibly damaging Het
Ehhadh A T 16: 21,592,295 (GRCm39) L136H probably damaging Het
Epha7 A G 4: 28,821,149 (GRCm39) T105A probably damaging Het
Etl4 A T 2: 20,748,965 (GRCm39) E434D probably benign Het
Fastkd2 T C 1: 63,770,968 (GRCm39) V108A probably benign Het
Fat2 G A 11: 55,174,962 (GRCm39) T1917I probably benign Het
Fbxo45 A G 16: 32,065,533 (GRCm39) S33P unknown Het
Fig4 A T 10: 41,143,711 (GRCm39) Y249* probably null Het
Fryl T C 5: 73,238,348 (GRCm39) Y1466C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Glod4 T C 11: 76,125,318 (GRCm39) D147G possibly damaging Het
Gm12695 T G 4: 96,651,046 (GRCm39) M136L probably benign Het
Gm5422 A G 10: 31,125,099 (GRCm39) T313A noncoding transcript Het
Hydin C A 8: 111,178,705 (GRCm39) A1100D probably benign Het
Ift172 G A 5: 31,422,681 (GRCm39) A923V possibly damaging Het
Irgc G A 7: 24,132,107 (GRCm39) H237Y probably damaging Het
Itga11 T C 9: 62,604,262 (GRCm39) I50T possibly damaging Het
Itpr3 C T 17: 27,334,887 (GRCm39) Q2134* probably null Het
Kat8 A T 7: 127,523,653 (GRCm39) D292V possibly damaging Het
Kdm2a A G 19: 4,374,392 (GRCm39) M913T possibly damaging Het
Larp4 T C 15: 99,883,961 (GRCm39) V66A probably benign Het
Loxhd1 A G 18: 77,462,858 (GRCm39) D899G probably damaging Het
Lrrc47 G T 4: 154,100,486 (GRCm39) R354L probably damaging Het
Lss C T 10: 76,367,739 (GRCm39) R24C probably damaging Het
Mmp14 C T 14: 54,673,244 (GRCm39) R51C probably damaging Het
Mon1a C T 9: 107,775,993 (GRCm39) T37I probably benign Het
Mtcl2 A G 2: 156,869,510 (GRCm39) W1042R possibly damaging Het
Nacc2 A C 2: 25,952,240 (GRCm39) V372G probably damaging Het
Ncapg T C 5: 45,849,134 (GRCm39) V690A probably benign Het
Nhej1 A G 1: 75,006,896 (GRCm39) L152P probably damaging Het
Nol4l A T 2: 153,259,337 (GRCm39) S522R probably damaging Het
Nr0b2 A G 4: 133,281,241 (GRCm39) Y169C probably damaging Het
Numa1 A G 7: 101,648,491 (GRCm39) M741V probably benign Het
Or10d1b A G 9: 39,613,453 (GRCm39) M204T possibly damaging Het
Or8g28 A G 9: 39,169,899 (GRCm39) L26P probably damaging Het
Pebp1 C A 5: 117,425,473 (GRCm39) probably null Het
Pik3ip1 A T 11: 3,291,581 (GRCm39) I217F probably damaging Het
Plekhg1 T A 10: 3,907,651 (GRCm39) I911N Het
Pnpla8 T C 12: 44,342,846 (GRCm39) I534T probably damaging Het
Ppp2r2a A T 14: 67,261,205 (GRCm39) F172I probably damaging Het
Rab7 C T 6: 87,989,292 (GRCm39) M59I probably benign Het
Rbm34 T C 8: 127,692,139 (GRCm39) N201S probably benign Het
Rfx1 G T 8: 84,821,483 (GRCm39) R764L probably damaging Het
Rnase12 T A 14: 51,294,580 (GRCm39) D33V probably damaging Het
Rnf121 A G 7: 101,684,532 (GRCm39) L127P probably damaging Het
Rtl1 C A 12: 109,560,180 (GRCm39) R553L probably damaging Het
Scn8a T C 15: 100,881,736 (GRCm39) L601P probably damaging Het
Scyl2 G T 10: 89,476,525 (GRCm39) Q867K possibly damaging Het
Sgtb T C 13: 104,268,692 (GRCm39) F213L probably benign Het
Slc35f4 A G 14: 49,551,084 (GRCm39) V260A probably damaging Het
Slfn14 A G 11: 83,174,299 (GRCm39) Y231H possibly damaging Het
Stard13 G A 5: 151,157,106 (GRCm39) A25V possibly damaging Het
Stk38 C T 17: 29,203,161 (GRCm39) R135H probably damaging Het
Svil A G 18: 5,108,679 (GRCm39) D1939G probably damaging Het
Tasor2 C T 13: 3,625,286 (GRCm39) V1555I possibly damaging Het
Tasor2 G T 13: 3,640,016 (GRCm39) P374T probably benign Het
Tbc1d7 A G 13: 43,323,340 (GRCm39) V17A possibly damaging Het
Trpc4 T C 3: 54,129,756 (GRCm39) V174A probably damaging Het
Ttn G T 2: 76,619,028 (GRCm39) T16117K probably damaging Het
Tubb3 T A 8: 124,147,868 (GRCm39) M267K possibly damaging Het
Upk1b T C 16: 38,604,585 (GRCm39) T147A probably damaging Het
Vmn2r107 G T 17: 20,580,614 (GRCm39) C517F probably damaging Het
Vmn2r112 A G 17: 22,824,140 (GRCm39) D465G probably damaging Het
Vmn2r73 A T 7: 85,507,619 (GRCm39) H564Q probably benign Het
Vmn2r79 A G 7: 86,686,726 (GRCm39) I702M possibly damaging Het
Vmn2r84 A G 10: 130,227,037 (GRCm39) V267A probably damaging Het
Zfp445 T C 9: 122,681,878 (GRCm39) I688V probably benign Het
Zfp955a C T 17: 33,463,087 (GRCm39) V15M probably damaging Het
Zfp960 T A 17: 17,308,202 (GRCm39) C305* probably null Het
Zfp964 A G 8: 70,116,345 (GRCm39) D315G possibly damaging Het
Zmynd10 T A 9: 107,426,516 (GRCm39) I183K possibly damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80,699,928 (GRCm39) missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80,701,175 (GRCm39) missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80,697,220 (GRCm39) missense probably benign 0.00
IGL01964:Sppl2b APN 10 80,701,220 (GRCm39) critical splice donor site probably null
IGL02376:Sppl2b APN 10 80,703,432 (GRCm39) nonsense probably null
R1641:Sppl2b UTSW 10 80,700,965 (GRCm39) missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80,701,451 (GRCm39) missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R3106:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R4350:Sppl2b UTSW 10 80,698,560 (GRCm39) missense probably benign 0.12
R5146:Sppl2b UTSW 10 80,703,474 (GRCm39) makesense probably null
R5698:Sppl2b UTSW 10 80,701,879 (GRCm39) splice site probably null
R6969:Sppl2b UTSW 10 80,700,959 (GRCm39) missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80,703,253 (GRCm39) missense probably benign 0.02
R8212:Sppl2b UTSW 10 80,701,193 (GRCm39) missense probably damaging 1.00
R8265:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8367:Sppl2b UTSW 10 80,699,025 (GRCm39) missense probably benign 0.02
R8398:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8398:Sppl2b UTSW 10 80,701,902 (GRCm39) frame shift probably null
R8400:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8480:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8481:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8505:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8817:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8818:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8832:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R9175:Sppl2b UTSW 10 80,698,807 (GRCm39) missense probably benign
R9624:Sppl2b UTSW 10 80,699,373 (GRCm39) missense probably benign 0.03
Z1176:Sppl2b UTSW 10 80,703,259 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGTGCATGCCCATTGTCAC -3'
(R):5'- TGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On 2020-07-28