Incidental Mutation 'R8263:Slc35f4'
ID 639817
Institutional Source Beutler Lab
Gene Symbol Slc35f4
Ensembl Gene ENSMUSG00000021852
Gene Name solute carrier family 35, member F4
Synonyms 4930550L21Rik
MMRRC Submission 067688-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R8263 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 49535976-49763354 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49551084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 260 (V260A)
Ref Sequence ENSEMBL: ENSMUSP00000073972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074368] [ENSMUST00000123534] [ENSMUST00000138884]
AlphaFold Q8BZK4
Predicted Effect probably damaging
Transcript: ENSMUST00000074368
AA Change: V260A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073972
Gene: ENSMUSG00000021852
AA Change: V260A

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:SLC35F 216 435 7.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123534
AA Change: V260A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122405
Gene: ENSMUSG00000021852
AA Change: V260A

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
transmembrane domain 217 234 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138884
AA Change: V110A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119007
Gene: ENSMUSG00000021852
AA Change: V110A

DomainStartEndE-ValueType
Pfam:EmrE 18 143 1e-12 PFAM
Pfam:EamA 57 135 8.4e-9 PFAM
Pfam:DUF914 68 314 4.8e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T A 1: 75,208,683 (GRCm39) R12S unknown Het
Ankrd10 C T 8: 11,665,707 (GRCm39) V298I probably benign Het
Atg4d T A 9: 21,178,335 (GRCm39) M151K probably damaging Het
Calhm5 C A 10: 33,972,192 (GRCm39) C81F probably damaging Het
Casp8ap2 T A 4: 32,644,072 (GRCm39) H1048Q probably damaging Het
Cd300ld2 A G 11: 114,903,192 (GRCm39) S218P unknown Het
Clec3a T C 8: 115,152,369 (GRCm39) V125A probably benign Het
Cnot6 A T 11: 49,573,002 (GRCm39) Y241N probably damaging Het
Dnah1 A T 14: 31,015,134 (GRCm39) F1686Y probably damaging Het
Dnah12 A G 14: 26,613,421 (GRCm39) K1285E noncoding transcript Het
Dop1b T C 16: 93,559,083 (GRCm39) S610P possibly damaging Het
Ehhadh A T 16: 21,592,295 (GRCm39) L136H probably damaging Het
Epha7 A G 4: 28,821,149 (GRCm39) T105A probably damaging Het
Etl4 A T 2: 20,748,965 (GRCm39) E434D probably benign Het
Fastkd2 T C 1: 63,770,968 (GRCm39) V108A probably benign Het
Fat2 G A 11: 55,174,962 (GRCm39) T1917I probably benign Het
Fbxo45 A G 16: 32,065,533 (GRCm39) S33P unknown Het
Fig4 A T 10: 41,143,711 (GRCm39) Y249* probably null Het
Fryl T C 5: 73,238,348 (GRCm39) Y1466C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Glod4 T C 11: 76,125,318 (GRCm39) D147G possibly damaging Het
Gm12695 T G 4: 96,651,046 (GRCm39) M136L probably benign Het
Gm5422 A G 10: 31,125,099 (GRCm39) T313A noncoding transcript Het
Hydin C A 8: 111,178,705 (GRCm39) A1100D probably benign Het
Ift172 G A 5: 31,422,681 (GRCm39) A923V possibly damaging Het
Irgc G A 7: 24,132,107 (GRCm39) H237Y probably damaging Het
Itga11 T C 9: 62,604,262 (GRCm39) I50T possibly damaging Het
Itpr3 C T 17: 27,334,887 (GRCm39) Q2134* probably null Het
Kat8 A T 7: 127,523,653 (GRCm39) D292V possibly damaging Het
Kdm2a A G 19: 4,374,392 (GRCm39) M913T possibly damaging Het
Larp4 T C 15: 99,883,961 (GRCm39) V66A probably benign Het
Loxhd1 A G 18: 77,462,858 (GRCm39) D899G probably damaging Het
Lrrc47 G T 4: 154,100,486 (GRCm39) R354L probably damaging Het
Lss C T 10: 76,367,739 (GRCm39) R24C probably damaging Het
Mmp14 C T 14: 54,673,244 (GRCm39) R51C probably damaging Het
Mon1a C T 9: 107,775,993 (GRCm39) T37I probably benign Het
Mtcl2 A G 2: 156,869,510 (GRCm39) W1042R possibly damaging Het
Nacc2 A C 2: 25,952,240 (GRCm39) V372G probably damaging Het
Ncapg T C 5: 45,849,134 (GRCm39) V690A probably benign Het
Nhej1 A G 1: 75,006,896 (GRCm39) L152P probably damaging Het
Nol4l A T 2: 153,259,337 (GRCm39) S522R probably damaging Het
Nr0b2 A G 4: 133,281,241 (GRCm39) Y169C probably damaging Het
Numa1 A G 7: 101,648,491 (GRCm39) M741V probably benign Het
Or10d1b A G 9: 39,613,453 (GRCm39) M204T possibly damaging Het
Or8g28 A G 9: 39,169,899 (GRCm39) L26P probably damaging Het
Pebp1 C A 5: 117,425,473 (GRCm39) probably null Het
Pik3ip1 A T 11: 3,291,581 (GRCm39) I217F probably damaging Het
Plekhg1 T A 10: 3,907,651 (GRCm39) I911N Het
Pnpla8 T C 12: 44,342,846 (GRCm39) I534T probably damaging Het
Ppp2r2a A T 14: 67,261,205 (GRCm39) F172I probably damaging Het
Rab7 C T 6: 87,989,292 (GRCm39) M59I probably benign Het
Rbm34 T C 8: 127,692,139 (GRCm39) N201S probably benign Het
Rfx1 G T 8: 84,821,483 (GRCm39) R764L probably damaging Het
Rnase12 T A 14: 51,294,580 (GRCm39) D33V probably damaging Het
Rnf121 A G 7: 101,684,532 (GRCm39) L127P probably damaging Het
Rtl1 C A 12: 109,560,180 (GRCm39) R553L probably damaging Het
Scn8a T C 15: 100,881,736 (GRCm39) L601P probably damaging Het
Scyl2 G T 10: 89,476,525 (GRCm39) Q867K possibly damaging Het
Sgtb T C 13: 104,268,692 (GRCm39) F213L probably benign Het
Slfn14 A G 11: 83,174,299 (GRCm39) Y231H possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Stard13 G A 5: 151,157,106 (GRCm39) A25V possibly damaging Het
Stk38 C T 17: 29,203,161 (GRCm39) R135H probably damaging Het
Svil A G 18: 5,108,679 (GRCm39) D1939G probably damaging Het
Tasor2 C T 13: 3,625,286 (GRCm39) V1555I possibly damaging Het
Tasor2 G T 13: 3,640,016 (GRCm39) P374T probably benign Het
Tbc1d7 A G 13: 43,323,340 (GRCm39) V17A possibly damaging Het
Trpc4 T C 3: 54,129,756 (GRCm39) V174A probably damaging Het
Ttn G T 2: 76,619,028 (GRCm39) T16117K probably damaging Het
Tubb3 T A 8: 124,147,868 (GRCm39) M267K possibly damaging Het
Upk1b T C 16: 38,604,585 (GRCm39) T147A probably damaging Het
Vmn2r107 G T 17: 20,580,614 (GRCm39) C517F probably damaging Het
Vmn2r112 A G 17: 22,824,140 (GRCm39) D465G probably damaging Het
Vmn2r73 A T 7: 85,507,619 (GRCm39) H564Q probably benign Het
Vmn2r79 A G 7: 86,686,726 (GRCm39) I702M possibly damaging Het
Vmn2r84 A G 10: 130,227,037 (GRCm39) V267A probably damaging Het
Zfp445 T C 9: 122,681,878 (GRCm39) I688V probably benign Het
Zfp955a C T 17: 33,463,087 (GRCm39) V15M probably damaging Het
Zfp960 T A 17: 17,308,202 (GRCm39) C305* probably null Het
Zfp964 A G 8: 70,116,345 (GRCm39) D315G possibly damaging Het
Zmynd10 T A 9: 107,426,516 (GRCm39) I183K possibly damaging Het
Other mutations in Slc35f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc35f4 APN 14 49,536,334 (GRCm39) missense probably benign 0.15
IGL01640:Slc35f4 APN 14 49,556,225 (GRCm39) missense probably damaging 0.99
IGL01942:Slc35f4 APN 14 49,762,962 (GRCm39) splice site probably benign
IGL01990:Slc35f4 APN 14 49,541,626 (GRCm39) critical splice donor site probably null
IGL02097:Slc35f4 APN 14 49,543,703 (GRCm39) missense probably damaging 1.00
IGL02803:Slc35f4 APN 14 49,541,714 (GRCm39) missense probably benign 0.00
R0005:Slc35f4 UTSW 14 49,559,943 (GRCm39) splice site probably benign
R0238:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0238:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0764:Slc35f4 UTSW 14 49,543,796 (GRCm39) splice site probably benign
R1884:Slc35f4 UTSW 14 49,551,091 (GRCm39) missense probably damaging 1.00
R1916:Slc35f4 UTSW 14 49,541,380 (GRCm39) intron probably benign
R2047:Slc35f4 UTSW 14 49,541,029 (GRCm39) intron probably benign
R2239:Slc35f4 UTSW 14 49,543,660 (GRCm39) critical splice donor site probably null
R2380:Slc35f4 UTSW 14 49,543,660 (GRCm39) critical splice donor site probably null
R4273:Slc35f4 UTSW 14 49,541,758 (GRCm39) missense possibly damaging 0.81
R4420:Slc35f4 UTSW 14 49,551,034 (GRCm39) unclassified probably benign
R4425:Slc35f4 UTSW 14 49,556,307 (GRCm39) missense possibly damaging 0.85
R5261:Slc35f4 UTSW 14 49,540,946 (GRCm39) intron probably benign
R5398:Slc35f4 UTSW 14 49,536,304 (GRCm39) missense probably damaging 1.00
R5402:Slc35f4 UTSW 14 49,556,331 (GRCm39) missense probably damaging 1.00
R6310:Slc35f4 UTSW 14 49,559,914 (GRCm39) missense probably damaging 1.00
R6596:Slc35f4 UTSW 14 49,763,057 (GRCm39) missense probably damaging 1.00
R6729:Slc35f4 UTSW 14 49,556,417 (GRCm39) missense probably benign 0.16
R6864:Slc35f4 UTSW 14 49,556,310 (GRCm39) missense possibly damaging 0.55
R7427:Slc35f4 UTSW 14 49,536,355 (GRCm39) missense probably damaging 0.99
R7428:Slc35f4 UTSW 14 49,536,355 (GRCm39) missense probably damaging 0.99
R7559:Slc35f4 UTSW 14 49,541,732 (GRCm39) missense probably benign 0.03
R7596:Slc35f4 UTSW 14 49,543,666 (GRCm39) missense probably damaging 1.00
R7722:Slc35f4 UTSW 14 49,543,731 (GRCm39) missense probably benign 0.22
R8525:Slc35f4 UTSW 14 49,541,681 (GRCm39) missense possibly damaging 0.56
R9198:Slc35f4 UTSW 14 49,556,377 (GRCm39) missense unknown
R9615:Slc35f4 UTSW 14 49,556,306 (GRCm39) missense probably benign 0.00
R9751:Slc35f4 UTSW 14 49,536,291 (GRCm39) missense possibly damaging 0.49
R9772:Slc35f4 UTSW 14 49,551,175 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTAATCAACTGACTCCCCAG -3'
(R):5'- AGATGGCCTGACACTGAAGC -3'

Sequencing Primer
(F):5'- ACGATGCTGTCACTGCC -3'
(R):5'- GGCCTGACACTGAAGCTCTTTC -3'
Posted On 2020-07-28