Incidental Mutation 'R8263:Larp4'
ID639821
Institutional Source Beutler Lab
Gene Symbol Larp4
Ensembl Gene ENSMUSG00000023025
Gene NameLa ribonucleoprotein domain family, member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R8263 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location99970065-100016358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99986080 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 66 (V66A)
Ref Sequence ENSEMBL: ENSMUSP00000097780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057632] [ENSMUST00000100206]
Predicted Effect probably benign
Transcript: ENSMUST00000057632
AA Change: V65A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086964
Gene: ENSMUSG00000023025
AA Change: V65A

DomainStartEndE-ValueType
LA 112 190 2.44e-40 SMART
RRM 195 265 3.28e-2 SMART
low complexity region 375 388 N/A INTRINSIC
low complexity region 433 453 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100206
AA Change: V66A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097780
Gene: ENSMUSG00000023025
AA Change: V66A

DomainStartEndE-ValueType
LA 113 191 2.44e-40 SMART
RRM 196 266 3.28e-2 SMART
low complexity region 376 389 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 652 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T A 1: 75,232,039 R12S unknown Het
Ankrd10 C T 8: 11,615,707 V298I probably benign Het
Atg4d T A 9: 21,267,039 M151K probably damaging Het
Casp8ap2 T A 4: 32,644,072 H1048Q probably damaging Het
Cd300ld2 A G 11: 115,012,366 S218P unknown Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Cnot6 A T 11: 49,682,175 Y241N probably damaging Het
Dnah1 A T 14: 31,293,177 F1686Y probably damaging Het
Dnah12 A G 14: 26,891,464 K1285E noncoding transcript Het
Dopey2 T C 16: 93,762,195 S610P possibly damaging Het
Ehhadh A T 16: 21,773,545 L136H probably damaging Het
Epha7 A G 4: 28,821,149 T105A probably damaging Het
Etl4 A T 2: 20,744,154 E434D probably benign Het
Fam208b C T 13: 3,575,286 V1555I possibly damaging Het
Fam208b G T 13: 3,590,016 P374T probably benign Het
Fam26e C A 10: 34,096,196 C81F probably damaging Het
Fastkd2 T C 1: 63,731,809 V108A probably benign Het
Fat2 G A 11: 55,284,136 T1917I probably benign Het
Fbxo45 A G 16: 32,246,715 S33P unknown Het
Fig4 A T 10: 41,267,715 Y249* probably null Het
Fryl T C 5: 73,081,005 Y1466C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Glod4 T C 11: 76,234,492 D147G possibly damaging Het
Gm12695 T G 4: 96,762,809 M136L probably benign Het
Gm5422 A G 10: 31,249,103 T313A noncoding transcript Het
Hydin C A 8: 110,452,073 A1100D probably benign Het
Ift172 G A 5: 31,265,337 A923V possibly damaging Het
Irgc1 G A 7: 24,432,682 H237Y probably damaging Het
Itga11 T C 9: 62,696,980 I50T possibly damaging Het
Itpr3 C T 17: 27,115,913 Q2134* probably null Het
Kat8 A T 7: 127,924,481 D292V possibly damaging Het
Kdm2a A G 19: 4,324,364 M913T possibly damaging Het
Loxhd1 A G 18: 77,375,162 D899G probably damaging Het
Lrrc47 G T 4: 154,016,029 R354L probably damaging Het
Lss C T 10: 76,531,905 R24C probably damaging Het
Mmp14 C T 14: 54,435,787 R51C probably damaging Het
Mon1a C T 9: 107,898,794 T37I probably benign Het
Nacc2 A C 2: 26,062,228 V372G probably damaging Het
Ncapg T C 5: 45,691,792 V690A probably benign Het
Nhej1 A G 1: 74,967,737 L152P probably damaging Het
Nol4l A T 2: 153,417,417 S522R probably damaging Het
Nr0b2 A G 4: 133,553,930 Y169C probably damaging Het
Numa1 A G 7: 101,999,284 M741V probably benign Het
Olfr149 A G 9: 39,702,157 M204T possibly damaging Het
Olfr945 A G 9: 39,258,603 L26P probably damaging Het
Pebp1 C A 5: 117,287,408 probably null Het
Pik3ip1 A T 11: 3,341,581 I217F probably damaging Het
Plekhg1 T A 10: 3,957,651 I911N Het
Pnpla8 T C 12: 44,296,063 I534T probably damaging Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Rab7 C T 6: 88,012,310 M59I probably benign Het
Rbm34 T C 8: 126,965,389 N201S probably benign Het
Rfx1 G T 8: 84,094,854 R764L probably damaging Het
Rnase12 T A 14: 51,057,123 D33V probably damaging Het
Rnf121 A G 7: 102,035,325 L127P probably damaging Het
Rtl1 C A 12: 109,593,746 R553L probably damaging Het
Scn8a T C 15: 100,983,855 L601P probably damaging Het
Scyl2 G T 10: 89,640,663 Q867K possibly damaging Het
Sgtb T C 13: 104,132,184 F213L probably benign Het
Slc35f4 A G 14: 49,313,627 V260A probably damaging Het
Slfn14 A G 11: 83,283,473 Y231H possibly damaging Het
Soga1 A G 2: 157,027,590 W1042R possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stard13 G A 5: 151,233,641 A25V possibly damaging Het
Stk38 C T 17: 28,984,187 R135H probably damaging Het
Svil A G 18: 5,108,679 D1939G probably damaging Het
Tbc1d7 A G 13: 43,169,864 V17A possibly damaging Het
Trpc4 T C 3: 54,222,335 V174A probably damaging Het
Ttn G T 2: 76,788,684 T16117K probably damaging Het
Tubb3 T A 8: 123,421,129 M267K possibly damaging Het
Upk1b T C 16: 38,784,223 T147A probably damaging Het
Vmn2r107 G T 17: 20,360,352 C517F probably damaging Het
Vmn2r112 A G 17: 22,605,159 D465G probably damaging Het
Vmn2r73 A T 7: 85,858,411 H564Q probably benign Het
Vmn2r79 A G 7: 87,037,518 I702M possibly damaging Het
Vmn2r84 A G 10: 130,391,168 V267A probably damaging Het
Zfp445 T C 9: 122,852,813 I688V probably benign Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Zfp960 T A 17: 17,087,940 C305* probably null Het
Zfp964 A G 8: 69,663,695 D315G possibly damaging Het
Zmynd10 T A 9: 107,549,317 I183K possibly damaging Het
Other mutations in Larp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Larp4 APN 15 99987421 missense probably damaging 0.98
IGL01668:Larp4 APN 15 99987474 missense probably damaging 1.00
IGL01687:Larp4 APN 15 99996488 missense probably damaging 1.00
IGL02105:Larp4 APN 15 99986071 missense probably damaging 1.00
IGL02676:Larp4 APN 15 99990421 missense possibly damaging 0.94
IGL03286:Larp4 APN 15 99986086 missense probably damaging 1.00
Skewer UTSW 15 100007730 critical splice donor site probably null
R1076:Larp4 UTSW 15 99997430 missense probably benign 0.00
R1996:Larp4 UTSW 15 99984963 missense probably damaging 1.00
R2183:Larp4 UTSW 15 100011897 missense probably benign 0.16
R2260:Larp4 UTSW 15 99997396 missense possibly damaging 0.95
R3777:Larp4 UTSW 15 99990357 missense probably damaging 1.00
R3916:Larp4 UTSW 15 99990403 missense probably benign 0.00
R3962:Larp4 UTSW 15 100012145 missense probably damaging 1.00
R5059:Larp4 UTSW 15 100005290 missense probably damaging 1.00
R5081:Larp4 UTSW 15 99973017 intron probably benign
R5104:Larp4 UTSW 15 99986083 missense probably damaging 1.00
R5409:Larp4 UTSW 15 99986064 missense probably damaging 0.98
R5436:Larp4 UTSW 15 99986114 missense probably damaging 0.98
R6895:Larp4 UTSW 15 100007730 critical splice donor site probably null
R7316:Larp4 UTSW 15 100001017 missense probably benign
R7483:Larp4 UTSW 15 99991778 missense probably benign 0.01
R7510:Larp4 UTSW 15 99993377 missense probably benign 0.07
R8131:Larp4 UTSW 15 99994689 missense probably damaging 0.99
R8322:Larp4 UTSW 15 100010356 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTTGGGTACATAGAGTGCTACC -3'
(R):5'- TGTCATGTTTACGGAAATGACG -3'

Sequencing Primer
(F):5'- GGGTACATAGAGTGCTACCTTATCC -3'
(R):5'- CGGAGAGCTAAAGACACTAAGTTCTC -3'
Posted On2020-07-28