Incidental Mutation 'R8263:Larp4'
ID 639821
Institutional Source Beutler Lab
Gene Symbol Larp4
Ensembl Gene ENSMUSG00000023025
Gene Name La ribonucleoprotein 4
Synonyms D330037H05Rik
MMRRC Submission 067688-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.413) question?
Stock # R8263 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99867946-99914239 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99883961 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 66 (V66A)
Ref Sequence ENSEMBL: ENSMUSP00000097780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057632] [ENSMUST00000100206]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000057632
AA Change: V65A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086964
Gene: ENSMUSG00000023025
AA Change: V65A

DomainStartEndE-ValueType
LA 112 190 2.44e-40 SMART
RRM 195 265 3.28e-2 SMART
low complexity region 375 388 N/A INTRINSIC
low complexity region 433 453 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100206
AA Change: V66A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097780
Gene: ENSMUSG00000023025
AA Change: V66A

DomainStartEndE-ValueType
LA 113 191 2.44e-40 SMART
RRM 196 266 3.28e-2 SMART
low complexity region 376 389 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 652 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T A 1: 75,208,683 (GRCm39) R12S unknown Het
Ankrd10 C T 8: 11,665,707 (GRCm39) V298I probably benign Het
Atg4d T A 9: 21,178,335 (GRCm39) M151K probably damaging Het
Calhm5 C A 10: 33,972,192 (GRCm39) C81F probably damaging Het
Casp8ap2 T A 4: 32,644,072 (GRCm39) H1048Q probably damaging Het
Cd300ld2 A G 11: 114,903,192 (GRCm39) S218P unknown Het
Clec3a T C 8: 115,152,369 (GRCm39) V125A probably benign Het
Cnot6 A T 11: 49,573,002 (GRCm39) Y241N probably damaging Het
Dnah1 A T 14: 31,015,134 (GRCm39) F1686Y probably damaging Het
Dnah12 A G 14: 26,613,421 (GRCm39) K1285E noncoding transcript Het
Dop1b T C 16: 93,559,083 (GRCm39) S610P possibly damaging Het
Ehhadh A T 16: 21,592,295 (GRCm39) L136H probably damaging Het
Epha7 A G 4: 28,821,149 (GRCm39) T105A probably damaging Het
Etl4 A T 2: 20,748,965 (GRCm39) E434D probably benign Het
Fastkd2 T C 1: 63,770,968 (GRCm39) V108A probably benign Het
Fat2 G A 11: 55,174,962 (GRCm39) T1917I probably benign Het
Fbxo45 A G 16: 32,065,533 (GRCm39) S33P unknown Het
Fig4 A T 10: 41,143,711 (GRCm39) Y249* probably null Het
Fryl T C 5: 73,238,348 (GRCm39) Y1466C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Glod4 T C 11: 76,125,318 (GRCm39) D147G possibly damaging Het
Gm12695 T G 4: 96,651,046 (GRCm39) M136L probably benign Het
Gm5422 A G 10: 31,125,099 (GRCm39) T313A noncoding transcript Het
Hydin C A 8: 111,178,705 (GRCm39) A1100D probably benign Het
Ift172 G A 5: 31,422,681 (GRCm39) A923V possibly damaging Het
Irgc G A 7: 24,132,107 (GRCm39) H237Y probably damaging Het
Itga11 T C 9: 62,604,262 (GRCm39) I50T possibly damaging Het
Itpr3 C T 17: 27,334,887 (GRCm39) Q2134* probably null Het
Kat8 A T 7: 127,523,653 (GRCm39) D292V possibly damaging Het
Kdm2a A G 19: 4,374,392 (GRCm39) M913T possibly damaging Het
Loxhd1 A G 18: 77,462,858 (GRCm39) D899G probably damaging Het
Lrrc47 G T 4: 154,100,486 (GRCm39) R354L probably damaging Het
Lss C T 10: 76,367,739 (GRCm39) R24C probably damaging Het
Mmp14 C T 14: 54,673,244 (GRCm39) R51C probably damaging Het
Mon1a C T 9: 107,775,993 (GRCm39) T37I probably benign Het
Mtcl2 A G 2: 156,869,510 (GRCm39) W1042R possibly damaging Het
Nacc2 A C 2: 25,952,240 (GRCm39) V372G probably damaging Het
Ncapg T C 5: 45,849,134 (GRCm39) V690A probably benign Het
Nhej1 A G 1: 75,006,896 (GRCm39) L152P probably damaging Het
Nol4l A T 2: 153,259,337 (GRCm39) S522R probably damaging Het
Nr0b2 A G 4: 133,281,241 (GRCm39) Y169C probably damaging Het
Numa1 A G 7: 101,648,491 (GRCm39) M741V probably benign Het
Or10d1b A G 9: 39,613,453 (GRCm39) M204T possibly damaging Het
Or8g28 A G 9: 39,169,899 (GRCm39) L26P probably damaging Het
Pebp1 C A 5: 117,425,473 (GRCm39) probably null Het
Pik3ip1 A T 11: 3,291,581 (GRCm39) I217F probably damaging Het
Plekhg1 T A 10: 3,907,651 (GRCm39) I911N Het
Pnpla8 T C 12: 44,342,846 (GRCm39) I534T probably damaging Het
Ppp2r2a A T 14: 67,261,205 (GRCm39) F172I probably damaging Het
Rab7 C T 6: 87,989,292 (GRCm39) M59I probably benign Het
Rbm34 T C 8: 127,692,139 (GRCm39) N201S probably benign Het
Rfx1 G T 8: 84,821,483 (GRCm39) R764L probably damaging Het
Rnase12 T A 14: 51,294,580 (GRCm39) D33V probably damaging Het
Rnf121 A G 7: 101,684,532 (GRCm39) L127P probably damaging Het
Rtl1 C A 12: 109,560,180 (GRCm39) R553L probably damaging Het
Scn8a T C 15: 100,881,736 (GRCm39) L601P probably damaging Het
Scyl2 G T 10: 89,476,525 (GRCm39) Q867K possibly damaging Het
Sgtb T C 13: 104,268,692 (GRCm39) F213L probably benign Het
Slc35f4 A G 14: 49,551,084 (GRCm39) V260A probably damaging Het
Slfn14 A G 11: 83,174,299 (GRCm39) Y231H possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Stard13 G A 5: 151,157,106 (GRCm39) A25V possibly damaging Het
Stk38 C T 17: 29,203,161 (GRCm39) R135H probably damaging Het
Svil A G 18: 5,108,679 (GRCm39) D1939G probably damaging Het
Tasor2 C T 13: 3,625,286 (GRCm39) V1555I possibly damaging Het
Tasor2 G T 13: 3,640,016 (GRCm39) P374T probably benign Het
Tbc1d7 A G 13: 43,323,340 (GRCm39) V17A possibly damaging Het
Trpc4 T C 3: 54,129,756 (GRCm39) V174A probably damaging Het
Ttn G T 2: 76,619,028 (GRCm39) T16117K probably damaging Het
Tubb3 T A 8: 124,147,868 (GRCm39) M267K possibly damaging Het
Upk1b T C 16: 38,604,585 (GRCm39) T147A probably damaging Het
Vmn2r107 G T 17: 20,580,614 (GRCm39) C517F probably damaging Het
Vmn2r112 A G 17: 22,824,140 (GRCm39) D465G probably damaging Het
Vmn2r73 A T 7: 85,507,619 (GRCm39) H564Q probably benign Het
Vmn2r79 A G 7: 86,686,726 (GRCm39) I702M possibly damaging Het
Vmn2r84 A G 10: 130,227,037 (GRCm39) V267A probably damaging Het
Zfp445 T C 9: 122,681,878 (GRCm39) I688V probably benign Het
Zfp955a C T 17: 33,463,087 (GRCm39) V15M probably damaging Het
Zfp960 T A 17: 17,308,202 (GRCm39) C305* probably null Het
Zfp964 A G 8: 70,116,345 (GRCm39) D315G possibly damaging Het
Zmynd10 T A 9: 107,426,516 (GRCm39) I183K possibly damaging Het
Other mutations in Larp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Larp4 APN 15 99,885,302 (GRCm39) missense probably damaging 0.98
IGL01668:Larp4 APN 15 99,885,355 (GRCm39) missense probably damaging 1.00
IGL01687:Larp4 APN 15 99,894,369 (GRCm39) missense probably damaging 1.00
IGL02105:Larp4 APN 15 99,883,952 (GRCm39) missense probably damaging 1.00
IGL02676:Larp4 APN 15 99,888,302 (GRCm39) missense possibly damaging 0.94
IGL03286:Larp4 APN 15 99,883,967 (GRCm39) missense probably damaging 1.00
Skewer UTSW 15 99,905,611 (GRCm39) critical splice donor site probably null
R1076:Larp4 UTSW 15 99,895,311 (GRCm39) missense probably benign 0.00
R1996:Larp4 UTSW 15 99,882,844 (GRCm39) missense probably damaging 1.00
R2183:Larp4 UTSW 15 99,909,778 (GRCm39) missense probably benign 0.16
R2260:Larp4 UTSW 15 99,895,277 (GRCm39) missense possibly damaging 0.95
R3777:Larp4 UTSW 15 99,888,238 (GRCm39) missense probably damaging 1.00
R3916:Larp4 UTSW 15 99,888,284 (GRCm39) missense probably benign 0.00
R3962:Larp4 UTSW 15 99,910,026 (GRCm39) missense probably damaging 1.00
R5059:Larp4 UTSW 15 99,903,171 (GRCm39) missense probably damaging 1.00
R5081:Larp4 UTSW 15 99,870,898 (GRCm39) intron probably benign
R5104:Larp4 UTSW 15 99,883,964 (GRCm39) missense probably damaging 1.00
R5409:Larp4 UTSW 15 99,883,945 (GRCm39) missense probably damaging 0.98
R5436:Larp4 UTSW 15 99,883,995 (GRCm39) missense probably damaging 0.98
R6895:Larp4 UTSW 15 99,905,611 (GRCm39) critical splice donor site probably null
R7316:Larp4 UTSW 15 99,898,898 (GRCm39) missense probably benign
R7483:Larp4 UTSW 15 99,889,659 (GRCm39) missense probably benign 0.01
R7510:Larp4 UTSW 15 99,891,258 (GRCm39) missense probably benign 0.07
R8131:Larp4 UTSW 15 99,892,570 (GRCm39) missense probably damaging 0.99
R8322:Larp4 UTSW 15 99,908,237 (GRCm39) missense probably benign 0.01
R8671:Larp4 UTSW 15 99,908,339 (GRCm39) missense probably benign 0.01
R9059:Larp4 UTSW 15 99,889,693 (GRCm39) missense probably benign 0.26
R9151:Larp4 UTSW 15 99,888,205 (GRCm39) missense possibly damaging 0.88
R9444:Larp4 UTSW 15 99,909,807 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTTGGGTACATAGAGTGCTACC -3'
(R):5'- TGTCATGTTTACGGAAATGACG -3'

Sequencing Primer
(F):5'- GGGTACATAGAGTGCTACCTTATCC -3'
(R):5'- CGGAGAGCTAAAGACACTAAGTTCTC -3'
Posted On 2020-07-28