Incidental Mutation 'R8263:Itpr3'
ID 639830
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms tf, Ip3r3, Itpr-3
MMRRC Submission 067688-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8263 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 27057304-27122223 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 27115913 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 2134 (Q2134*)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
AlphaFold P70227
PDB Structure Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000049308
AA Change: Q2134*
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: Q2134*

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T A 1: 75,232,039 R12S unknown Het
Ankrd10 C T 8: 11,615,707 V298I probably benign Het
Atg4d T A 9: 21,267,039 M151K probably damaging Het
Casp8ap2 T A 4: 32,644,072 H1048Q probably damaging Het
Cd300ld2 A G 11: 115,012,366 S218P unknown Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Cnot6 A T 11: 49,682,175 Y241N probably damaging Het
Dnah1 A T 14: 31,293,177 F1686Y probably damaging Het
Dnah12 A G 14: 26,891,464 K1285E noncoding transcript Het
Dopey2 T C 16: 93,762,195 S610P possibly damaging Het
Ehhadh A T 16: 21,773,545 L136H probably damaging Het
Epha7 A G 4: 28,821,149 T105A probably damaging Het
Etl4 A T 2: 20,744,154 E434D probably benign Het
Fam208b C T 13: 3,575,286 V1555I possibly damaging Het
Fam208b G T 13: 3,590,016 P374T probably benign Het
Fam26e C A 10: 34,096,196 C81F probably damaging Het
Fastkd2 T C 1: 63,731,809 V108A probably benign Het
Fat2 G A 11: 55,284,136 T1917I probably benign Het
Fbxo45 A G 16: 32,246,715 S33P unknown Het
Fig4 A T 10: 41,267,715 Y249* probably null Het
Fryl T C 5: 73,081,005 Y1466C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Glod4 T C 11: 76,234,492 D147G possibly damaging Het
Gm12695 T G 4: 96,762,809 M136L probably benign Het
Gm5422 A G 10: 31,249,103 T313A noncoding transcript Het
Hydin C A 8: 110,452,073 A1100D probably benign Het
Ift172 G A 5: 31,265,337 A923V possibly damaging Het
Irgc1 G A 7: 24,432,682 H237Y probably damaging Het
Itga11 T C 9: 62,696,980 I50T possibly damaging Het
Kat8 A T 7: 127,924,481 D292V possibly damaging Het
Kdm2a A G 19: 4,324,364 M913T possibly damaging Het
Larp4 T C 15: 99,986,080 V66A probably benign Het
Loxhd1 A G 18: 77,375,162 D899G probably damaging Het
Lrrc47 G T 4: 154,016,029 R354L probably damaging Het
Lss C T 10: 76,531,905 R24C probably damaging Het
Mmp14 C T 14: 54,435,787 R51C probably damaging Het
Mon1a C T 9: 107,898,794 T37I probably benign Het
Nacc2 A C 2: 26,062,228 V372G probably damaging Het
Ncapg T C 5: 45,691,792 V690A probably benign Het
Nhej1 A G 1: 74,967,737 L152P probably damaging Het
Nol4l A T 2: 153,417,417 S522R probably damaging Het
Nr0b2 A G 4: 133,553,930 Y169C probably damaging Het
Numa1 A G 7: 101,999,284 M741V probably benign Het
Olfr149 A G 9: 39,702,157 M204T possibly damaging Het
Olfr945 A G 9: 39,258,603 L26P probably damaging Het
Pebp1 C A 5: 117,287,408 probably null Het
Pik3ip1 A T 11: 3,341,581 I217F probably damaging Het
Plekhg1 T A 10: 3,957,651 I911N Het
Pnpla8 T C 12: 44,296,063 I534T probably damaging Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Rab7 C T 6: 88,012,310 M59I probably benign Het
Rbm34 T C 8: 126,965,389 N201S probably benign Het
Rfx1 G T 8: 84,094,854 R764L probably damaging Het
Rnase12 T A 14: 51,057,123 D33V probably damaging Het
Rnf121 A G 7: 102,035,325 L127P probably damaging Het
Rtl1 C A 12: 109,593,746 R553L probably damaging Het
Scn8a T C 15: 100,983,855 L601P probably damaging Het
Scyl2 G T 10: 89,640,663 Q867K possibly damaging Het
Sgtb T C 13: 104,132,184 F213L probably benign Het
Slc35f4 A G 14: 49,313,627 V260A probably damaging Het
Slfn14 A G 11: 83,283,473 Y231H possibly damaging Het
Soga1 A G 2: 157,027,590 W1042R possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stard13 G A 5: 151,233,641 A25V possibly damaging Het
Stk38 C T 17: 28,984,187 R135H probably damaging Het
Svil A G 18: 5,108,679 D1939G probably damaging Het
Tbc1d7 A G 13: 43,169,864 V17A possibly damaging Het
Trpc4 T C 3: 54,222,335 V174A probably damaging Het
Ttn G T 2: 76,788,684 T16117K probably damaging Het
Tubb3 T A 8: 123,421,129 M267K possibly damaging Het
Upk1b T C 16: 38,784,223 T147A probably damaging Het
Vmn2r107 G T 17: 20,360,352 C517F probably damaging Het
Vmn2r112 A G 17: 22,605,159 D465G probably damaging Het
Vmn2r73 A T 7: 85,858,411 H564Q probably benign Het
Vmn2r79 A G 7: 87,037,518 I702M possibly damaging Het
Vmn2r84 A G 10: 130,391,168 V267A probably damaging Het
Zfp445 T C 9: 122,852,813 I688V probably benign Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Zfp960 T A 17: 17,087,940 C305* probably null Het
Zfp964 A G 8: 69,663,695 D315G possibly damaging Het
Zmynd10 T A 9: 107,549,317 I183K possibly damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
Allure UTSW 17 27107303 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27112028 critical splice donor site probably null
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8264:Itpr3 UTSW 17 27104112 synonymous silent
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27115919 missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27111926 missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27107303 missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27118677 unclassified probably benign
R8679:Itpr3 UTSW 17 27118677 unclassified probably benign
R8846:Itpr3 UTSW 17 27112022 missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27118677 unclassified probably benign
R8885:Itpr3 UTSW 17 27118677 unclassified probably benign
R8886:Itpr3 UTSW 17 27118677 unclassified probably benign
R8887:Itpr3 UTSW 17 27118677 unclassified probably benign
R8888:Itpr3 UTSW 17 27118677 unclassified probably benign
R8891:Itpr3 UTSW 17 27118677 unclassified probably benign
R8896:Itpr3 UTSW 17 27118677 unclassified probably benign
R8975:Itpr3 UTSW 17 27116654 missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27118677 unclassified probably benign
R9026:Itpr3 UTSW 17 27118677 unclassified probably benign
R9063:Itpr3 UTSW 17 27118677 unclassified probably benign
R9087:Itpr3 UTSW 17 27118677 unclassified probably benign
R9088:Itpr3 UTSW 17 27118677 unclassified probably benign
R9089:Itpr3 UTSW 17 27118677 unclassified probably benign
R9090:Itpr3 UTSW 17 27118677 unclassified probably benign
R9091:Itpr3 UTSW 17 27118677 unclassified probably benign
R9200:Itpr3 UTSW 17 27107662 missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27118677 unclassified probably benign
R9271:Itpr3 UTSW 17 27118677 unclassified probably benign
R9294:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27095925 missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27118677 unclassified probably benign
R9434:Itpr3 UTSW 17 27118677 unclassified probably benign
R9443:Itpr3 UTSW 17 27105549 missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27118677 unclassified probably benign
R9474:Itpr3 UTSW 17 27118677 unclassified probably benign
R9475:Itpr3 UTSW 17 27118677 unclassified probably benign
R9476:Itpr3 UTSW 17 27118677 unclassified probably benign
R9477:Itpr3 UTSW 17 27118677 unclassified probably benign
R9507:Itpr3 UTSW 17 27118677 unclassified probably benign
R9508:Itpr3 UTSW 17 27118677 unclassified probably benign
R9511:Itpr3 UTSW 17 27118677 unclassified probably benign
R9694:Itpr3 UTSW 17 27115953 missense probably damaging 0.99
R9789:Itpr3 UTSW 17 27089941 missense probably benign 0.15
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGCTGGCCTACTATGAGAATC -3'
(R):5'- ACCAGTAGATGAGCGGCATG -3'

Sequencing Primer
(F):5'- TATGAGAATCACACCTCGCAGATTG -3'
(R):5'- GTCCCTGACGAACCCTCTG -3'
Posted On 2020-07-28