Incidental Mutation 'R8262:Gm13762'
ID639840
Institutional Source Beutler Lab
Gene Symbol Gm13762
Ensembl Gene ENSMUSG00000075111
Gene Namepredicted gene 13762
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8262 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88972055-88980281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88973208 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 228 (S228R)
Ref Sequence ENSEMBL: ENSMUSP00000126588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099806] [ENSMUST00000168169]
Predicted Effect probably damaging
Transcript: ENSMUST00000099806
AA Change: S228R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097394
Gene: ENSMUSG00000101480
AA Change: S228R

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7tm_1 39 286 3.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168169
AA Change: S228R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126588
Gene: ENSMUSG00000075111
AA Change: S228R

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 1.8e-26 PFAM
Pfam:7tm_4 138 282 3.3e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,107,710 D358G possibly damaging Het
Adam26a A T 8: 43,569,141 C437* probably null Het
Arhgap10 A T 8: 77,310,839 C587S probably benign Het
Bank1 G A 3: 136,242,960 T285I probably benign Het
Bhlha15 C T 5: 144,191,439 S123L probably damaging Het
Cacul1 T C 19: 60,529,037 *305W probably null Het
Cep112 A C 11: 108,503,151 K365T probably damaging Het
Chrm1 T A 19: 8,679,089 L386Q probably damaging Het
Cnbp C A 6: 87,845,212 R110L probably damaging Het
Cntnap5a A T 1: 116,188,410 I541F possibly damaging Het
Dscaml1 T G 9: 45,747,140 probably benign Het
Enpp3 C T 10: 24,777,926 S711N probably damaging Het
Eps8 G T 6: 137,482,254 N750K probably benign Het
Fan1 G T 7: 64,373,306 N66K probably benign Het
Fbf1 G A 11: 116,154,019 T323I probably benign Het
Flg2 A T 3: 93,220,210 N2143I unknown Het
Fn3k A C 11: 121,448,918 T169P probably benign Het
Fubp1 T G 3: 152,220,719 I320R probably damaging Het
Gfpt2 A T 11: 49,823,780 E335D probably benign Het
Gm17472 T C 6: 42,981,034 I79T probably benign Het
Gpr151 C A 18: 42,578,372 E414* probably null Het
Gpr179 G A 11: 97,336,157 S1724L probably benign Het
Gtf2h3 C A 5: 124,590,904 Y175* probably null Het
Hal T A 10: 93,492,507 I215N probably damaging Het
Htt A G 5: 34,895,960 T2546A probably benign Het
Ighv1-11 T C 12: 114,612,457 Y46C probably damaging Het
Lcn4 T C 2: 26,668,363 D170G probably benign Het
Lrch1 T A 14: 74,818,495 D306V probably damaging Het
Mtcl1 A C 17: 66,343,658 V1604G probably damaging Het
Olfr1299 T G 2: 111,664,242 N5K possibly damaging Het
Olfr139 A G 11: 74,045,100 L58P probably damaging Het
Olfr1505 G A 19: 13,919,862 V281I probably benign Het
Olfr1513 T C 14: 52,349,168 N293D probably damaging Het
Ormdl2 A G 10: 128,818,968 L125P possibly damaging Het
Papd4 T C 13: 93,174,489 probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pde3a T A 6: 141,487,801 F803Y possibly damaging Het
Pnpla7 C T 2: 24,983,623 R214W probably damaging Het
Prtg T C 9: 72,906,238 V960A probably benign Het
Ptgdr T C 14: 44,853,401 E300G probably benign Het
Ptpru G T 4: 131,794,963 Y710* probably null Het
Pxdn T A 12: 29,999,196 Y620* probably null Het
Pycard T C 7: 127,993,625 D10G possibly damaging Het
Sh3d21 G T 4: 126,161,982 Q160K probably benign Het
Slc26a7 G A 4: 14,621,269 P39L probably benign Het
Snrnp200 T A 2: 127,227,008 Y936N probably damaging Het
Sox8 T C 17: 25,567,643 D362G possibly damaging Het
Tcp11 T G 17: 28,067,027 N538T probably damaging Het
Tmem132e A C 11: 82,434,840 E222A probably benign Het
Trpc7 T C 13: 56,789,789 E618G probably benign Het
Tsc2 G T 17: 24,614,366 Q695K probably benign Het
Txlnb C A 10: 17,843,004 L528M possibly damaging Het
Vmn1r176 A G 7: 23,835,453 Y92H probably benign Het
Vmn2r85 T A 10: 130,418,869 I649F probably damaging Het
Vwa8 T C 14: 78,933,832 probably null Het
Wrn A T 8: 33,324,246 I390N probably benign Het
Zfp493 T A 13: 67,786,857 C310S probably damaging Het
Other mutations in Gm13762
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0240:Gm13762 UTSW 2 88973396 missense probably damaging 1.00
R1446:Gm13762 UTSW 2 88973765 missense probably benign 0.00
R1845:Gm13762 UTSW 2 88973138 missense probably benign 0.22
R1868:Gm13762 UTSW 2 88973784 missense possibly damaging 0.60
R1953:Gm13762 UTSW 2 88973880 nonsense probably null
R4205:Gm13762 UTSW 2 88973138 missense probably benign 0.22
R4751:Gm13762 UTSW 2 88973133 missense probably damaging 1.00
R4895:Gm13762 UTSW 2 88973711 missense probably benign 0.39
R4937:Gm13762 UTSW 2 88973490 missense probably damaging 1.00
R5621:Gm13762 UTSW 2 88973466 missense probably benign 0.00
R5678:Gm13762 UTSW 2 88972973 nonsense probably null
R5938:Gm13762 UTSW 2 88973013 missense probably benign 0.00
R6021:Gm13762 UTSW 2 88973032 nonsense probably null
R6180:Gm13762 UTSW 2 88973882 missense probably damaging 1.00
R6724:Gm13762 UTSW 2 88973268 missense probably benign 0.02
R6873:Gm13762 UTSW 2 88973424 missense probably benign
R6893:Gm13762 UTSW 2 88973799 missense probably benign 0.00
R7221:Gm13762 UTSW 2 88973153 missense probably damaging 0.99
R7634:Gm13762 UTSW 2 88973657 missense probably damaging 1.00
R8233:Gm13762 UTSW 2 88973738 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATAGGATTTAGCAATGGTGTCAG -3'
(R):5'- GGAGGCTTCTTGCATTCTACC -3'

Sequencing Primer
(F):5'- TTAGCAATGGTGTCAGGATAGTAGC -3'
(R):5'- TTGTGGCCCCAATGTGATTGATC -3'
Posted On2020-07-28