Incidental Mutation 'R8262:Flg2'
ID 639843
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission 067687-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8262 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 93104585-93128698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93127517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 2143 (N2143I)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: N2143I
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: N2143I

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194443
AA Change: N123I
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,107,709 (GRCm39) D358G possibly damaging Het
Adam26a A T 8: 44,022,178 (GRCm39) C437* probably null Het
Arhgap10 A T 8: 78,037,468 (GRCm39) C587S probably benign Het
Bank1 G A 3: 135,948,721 (GRCm39) T285I probably benign Het
Bhlha15 C T 5: 144,128,257 (GRCm39) S123L probably damaging Het
Cacul1 T C 19: 60,517,475 (GRCm39) *305W probably null Het
Cep112 A C 11: 108,393,977 (GRCm39) K365T probably damaging Het
Chrm1 T A 19: 8,656,453 (GRCm39) L386Q probably damaging Het
Cnbp C A 6: 87,822,194 (GRCm39) R110L probably damaging Het
Cntnap5a A T 1: 116,116,140 (GRCm39) I541F possibly damaging Het
Dscaml1 T G 9: 45,658,438 (GRCm39) probably benign Het
Enpp3 C T 10: 24,653,824 (GRCm39) S711N probably damaging Het
Eps8 G T 6: 137,459,252 (GRCm39) N750K probably benign Het
Fan1 G T 7: 64,023,054 (GRCm39) N66K probably benign Het
Fbf1 G A 11: 116,044,845 (GRCm39) T323I probably benign Het
Fn3k A C 11: 121,339,744 (GRCm39) T169P probably benign Het
Fubp1 T G 3: 151,926,356 (GRCm39) I320R probably damaging Het
Gfpt2 A T 11: 49,714,607 (GRCm39) E335D probably benign Het
Gm17472 T C 6: 42,957,968 (GRCm39) I79T probably benign Het
Gpr151 C A 18: 42,711,437 (GRCm39) E414* probably null Het
Gpr179 G A 11: 97,226,983 (GRCm39) S1724L probably benign Het
Gtf2h3 C A 5: 124,728,967 (GRCm39) Y175* probably null Het
Hal T A 10: 93,328,369 (GRCm39) I215N probably damaging Het
Htt A G 5: 35,053,304 (GRCm39) T2546A probably benign Het
Ighv1-11 T C 12: 114,576,077 (GRCm39) Y46C probably damaging Het
Lcn4 T C 2: 26,558,375 (GRCm39) D170G probably benign Het
Lrch1 T A 14: 75,055,935 (GRCm39) D306V probably damaging Het
Mtcl1 A C 17: 66,650,653 (GRCm39) V1604G probably damaging Het
Or10g3b T C 14: 52,586,625 (GRCm39) N293D probably damaging Het
Or3a10 A G 11: 73,935,926 (GRCm39) L58P probably damaging Het
Or4c108 T G 2: 88,803,552 (GRCm39) S228R probably damaging Het
Or4k49 T G 2: 111,494,587 (GRCm39) N5K possibly damaging Het
Or9i1b G A 19: 13,897,226 (GRCm39) V281I probably benign Het
Ormdl2 A G 10: 128,654,837 (GRCm39) L125P possibly damaging Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Pde3a T A 6: 141,433,527 (GRCm39) F803Y possibly damaging Het
Pnpla7 C T 2: 24,873,635 (GRCm39) R214W probably damaging Het
Prtg T C 9: 72,813,520 (GRCm39) V960A probably benign Het
Ptgdr T C 14: 45,090,858 (GRCm39) E300G probably benign Het
Ptpru G T 4: 131,522,274 (GRCm39) Y710* probably null Het
Pxdn T A 12: 30,049,195 (GRCm39) Y620* probably null Het
Pycard T C 7: 127,592,797 (GRCm39) D10G possibly damaging Het
Sh3d21 G T 4: 126,055,775 (GRCm39) Q160K probably benign Het
Slc26a7 G A 4: 14,621,269 (GRCm39) P39L probably benign Het
Snrnp200 T A 2: 127,068,928 (GRCm39) Y936N probably damaging Het
Sox8 T C 17: 25,786,617 (GRCm39) D362G possibly damaging Het
Tcp11 T G 17: 28,286,001 (GRCm39) N538T probably damaging Het
Tent2 T C 13: 93,310,997 (GRCm39) probably benign Het
Tmem132e A C 11: 82,325,666 (GRCm39) E222A probably benign Het
Trpc7 T C 13: 56,937,602 (GRCm39) E618G probably benign Het
Tsc2 G T 17: 24,833,340 (GRCm39) Q695K probably benign Het
Txlnb C A 10: 17,718,752 (GRCm39) L528M possibly damaging Het
Vmn1r176 A G 7: 23,534,878 (GRCm39) Y92H probably benign Het
Vmn2r85 T A 10: 130,254,738 (GRCm39) I649F probably damaging Het
Vwa8 T C 14: 79,171,272 (GRCm39) probably null Het
Wrn A T 8: 33,814,274 (GRCm39) I390N probably benign Het
Zfp493 T A 13: 67,934,976 (GRCm39) C310S probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93,109,416 (GRCm39) nonsense probably null
IGL00092:Flg2 APN 3 93,127,162 (GRCm39) missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93,110,585 (GRCm39) missense unknown
IGL01077:Flg2 APN 3 93,127,513 (GRCm39) missense unknown
IGL01093:Flg2 APN 3 93,109,678 (GRCm39) missense unknown
IGL01120:Flg2 APN 3 93,108,475 (GRCm39) missense probably damaging 0.99
IGL01473:Flg2 APN 3 93,110,327 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,122,777 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,120,773 (GRCm39) missense unknown
IGL01686:Flg2 APN 3 93,109,591 (GRCm39) missense unknown
IGL02207:Flg2 APN 3 93,127,435 (GRCm39) missense unknown
IGL02294:Flg2 APN 3 93,111,053 (GRCm39) missense unknown
IGL02418:Flg2 APN 3 93,108,361 (GRCm39) missense probably benign 0.26
IGL02581:Flg2 APN 3 93,127,199 (GRCm39) missense unknown
IGL02719:Flg2 APN 3 93,127,438 (GRCm39) nonsense probably null
IGL02795:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02893:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02958:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03060:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03088:Flg2 APN 3 93,110,498 (GRCm39) missense unknown
IGL03165:Flg2 APN 3 93,121,918 (GRCm39) missense unknown
IGL03342:Flg2 APN 3 93,108,542 (GRCm39) missense probably damaging 1.00
IGL03352:Flg2 APN 3 93,109,801 (GRCm39) missense unknown
IGL02796:Flg2 UTSW 3 93,110,920 (GRCm39) missense unknown
IGL02837:Flg2 UTSW 3 93,109,044 (GRCm39) missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93,111,088 (GRCm39) missense unknown
R0087:Flg2 UTSW 3 93,109,738 (GRCm39) missense unknown
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0315:Flg2 UTSW 3 93,122,029 (GRCm39) missense unknown
R0390:Flg2 UTSW 3 93,107,662 (GRCm39) splice site probably benign
R0462:Flg2 UTSW 3 93,108,744 (GRCm39) missense probably benign 0.18
R0553:Flg2 UTSW 3 93,110,891 (GRCm39) missense unknown
R0828:Flg2 UTSW 3 93,110,639 (GRCm39) missense unknown
R1006:Flg2 UTSW 3 93,108,514 (GRCm39) missense probably benign 0.41
R1444:Flg2 UTSW 3 93,109,620 (GRCm39) missense unknown
R1497:Flg2 UTSW 3 93,127,076 (GRCm39) missense unknown
R1518:Flg2 UTSW 3 93,110,445 (GRCm39) missense unknown
R1737:Flg2 UTSW 3 93,110,928 (GRCm39) missense unknown
R1780:Flg2 UTSW 3 93,110,306 (GRCm39) missense unknown
R1797:Flg2 UTSW 3 93,108,283 (GRCm39) missense probably damaging 1.00
R2065:Flg2 UTSW 3 93,109,538 (GRCm39) missense unknown
R2168:Flg2 UTSW 3 93,109,244 (GRCm39) missense probably damaging 1.00
R2220:Flg2 UTSW 3 93,109,492 (GRCm39) missense unknown
R2292:Flg2 UTSW 3 93,127,984 (GRCm39) missense unknown
R2327:Flg2 UTSW 3 93,110,913 (GRCm39) nonsense probably null
R2512:Flg2 UTSW 3 93,109,082 (GRCm39) missense probably damaging 1.00
R3177:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3277:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3522:Flg2 UTSW 3 93,127,334 (GRCm39) missense unknown
R3779:Flg2 UTSW 3 93,109,730 (GRCm39) missense unknown
R3926:Flg2 UTSW 3 93,110,522 (GRCm39) missense unknown
R4082:Flg2 UTSW 3 93,110,828 (GRCm39) missense unknown
R4407:Flg2 UTSW 3 93,122,176 (GRCm39) missense unknown
R5152:Flg2 UTSW 3 93,122,284 (GRCm39) missense unknown
R5253:Flg2 UTSW 3 93,108,119 (GRCm39) missense probably damaging 1.00
R5290:Flg2 UTSW 3 93,127,873 (GRCm39) missense unknown
R5464:Flg2 UTSW 3 93,109,277 (GRCm39) missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93,127,753 (GRCm39) missense unknown
R5622:Flg2 UTSW 3 93,109,871 (GRCm39) missense unknown
R5788:Flg2 UTSW 3 93,108,296 (GRCm39) missense probably benign 0.41
R5792:Flg2 UTSW 3 93,110,804 (GRCm39) missense unknown
R5831:Flg2 UTSW 3 93,107,541 (GRCm39) missense probably damaging 1.00
R5877:Flg2 UTSW 3 93,110,756 (GRCm39) missense unknown
R6041:Flg2 UTSW 3 93,127,668 (GRCm39) missense probably benign 0.01
R6189:Flg2 UTSW 3 93,127,381 (GRCm39) missense unknown
R6214:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93,108,579 (GRCm39) missense probably benign 0.36
R6288:Flg2 UTSW 3 93,111,092 (GRCm39) missense unknown
R6413:Flg2 UTSW 3 93,127,683 (GRCm39) missense unknown
R6457:Flg2 UTSW 3 93,127,789 (GRCm39) missense unknown
R6468:Flg2 UTSW 3 93,121,728 (GRCm39) missense unknown
R6667:Flg2 UTSW 3 93,109,068 (GRCm39) missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93,108,642 (GRCm39) nonsense probably null
R6996:Flg2 UTSW 3 93,110,256 (GRCm39) missense unknown
R6996:Flg2 UTSW 3 93,109,977 (GRCm39) missense unknown
R7100:Flg2 UTSW 3 93,111,018 (GRCm39) missense unknown
R7133:Flg2 UTSW 3 93,127,069 (GRCm39) missense unknown
R7180:Flg2 UTSW 3 93,110,140 (GRCm39) missense unknown
R7325:Flg2 UTSW 3 93,110,679 (GRCm39) missense unknown
R7349:Flg2 UTSW 3 93,127,513 (GRCm39) missense unknown
R7531:Flg2 UTSW 3 93,108,177 (GRCm39) missense probably damaging 0.99
R7571:Flg2 UTSW 3 93,127,303 (GRCm39) nonsense probably null
R7684:Flg2 UTSW 3 93,126,956 (GRCm39) missense unknown
R7810:Flg2 UTSW 3 93,107,548 (GRCm39) missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93,128,054 (GRCm39) missense unknown
R8031:Flg2 UTSW 3 93,127,521 (GRCm39) missense unknown
R8078:Flg2 UTSW 3 93,107,582 (GRCm39) missense probably damaging 1.00
R8142:Flg2 UTSW 3 93,122,782 (GRCm39) nonsense probably null
R8156:Flg2 UTSW 3 93,127,390 (GRCm39) missense unknown
R8172:Flg2 UTSW 3 93,108,468 (GRCm39) missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93,110,074 (GRCm39) missense unknown
R8269:Flg2 UTSW 3 93,109,187 (GRCm39) missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93,110,069 (GRCm39) missense unknown
R8444:Flg2 UTSW 3 93,107,585 (GRCm39) missense probably damaging 0.97
R8670:Flg2 UTSW 3 93,108,791 (GRCm39) missense probably damaging 0.97
R8755:Flg2 UTSW 3 93,108,120 (GRCm39) missense probably damaging 1.00
R9039:Flg2 UTSW 3 93,110,899 (GRCm39) missense unknown
R9116:Flg2 UTSW 3 93,109,591 (GRCm39) missense unknown
R9214:Flg2 UTSW 3 93,110,884 (GRCm39) missense unknown
R9231:Flg2 UTSW 3 93,109,508 (GRCm39) missense unknown
R9553:Flg2 UTSW 3 93,121,901 (GRCm39) missense unknown
R9607:Flg2 UTSW 3 93,108,719 (GRCm39) missense probably damaging 0.98
R9735:Flg2 UTSW 3 93,127,669 (GRCm39) missense unknown
R9752:Flg2 UTSW 3 93,108,467 (GRCm39) missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93,110,045 (GRCm39) missense unknown
Z1177:Flg2 UTSW 3 93,109,727 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTGCACATAGAGCAACAAATATGG -3'
(R):5'- GCCTTTCATTAGGGCTGAATCC -3'

Sequencing Primer
(F):5'- GAAGTCTTACCTTGTGGACAGTC -3'
(R):5'- GGCTGAATCCAGACTGATTTCC -3'
Posted On 2020-07-28