Incidental Mutation 'R8262:Flg2'
ID639843
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8262 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93220210 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 2143 (N2143I)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: N2143I
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: N2143I

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194443
AA Change: N123I
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,107,710 D358G possibly damaging Het
Adam26a A T 8: 43,569,141 C437* probably null Het
Arhgap10 A T 8: 77,310,839 C587S probably benign Het
Bank1 G A 3: 136,242,960 T285I probably benign Het
Bhlha15 C T 5: 144,191,439 S123L probably damaging Het
Cacul1 T C 19: 60,529,037 *305W probably null Het
Cep112 A C 11: 108,503,151 K365T probably damaging Het
Chrm1 T A 19: 8,679,089 L386Q probably damaging Het
Cnbp C A 6: 87,845,212 R110L probably damaging Het
Cntnap5a A T 1: 116,188,410 I541F possibly damaging Het
Enpp3 C T 10: 24,777,926 S711N probably damaging Het
Eps8 G T 6: 137,482,254 N750K probably benign Het
Fan1 G T 7: 64,373,306 N66K probably benign Het
Fbf1 G A 11: 116,154,019 T323I probably benign Het
Fn3k A C 11: 121,448,918 T169P probably benign Het
Fubp1 T G 3: 152,220,719 I320R probably damaging Het
Gfpt2 A T 11: 49,823,780 E335D probably benign Het
Gm13762 T G 2: 88,973,208 S228R probably damaging Het
Gm17472 T C 6: 42,981,034 I79T probably benign Het
Gpr151 C A 18: 42,578,372 E414* probably null Het
Gpr179 G A 11: 97,336,157 S1724L probably benign Het
Gtf2h3 C A 5: 124,590,904 Y175* probably null Het
Hal T A 10: 93,492,507 I215N probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Htt A G 5: 34,895,960 T2546A probably benign Het
Ighv1-11 T C 12: 114,612,457 Y46C probably damaging Het
Lcn4 T C 2: 26,668,363 D170G probably benign Het
Lrch1 T A 14: 74,818,495 D306V probably damaging Het
Mtcl1 A C 17: 66,343,658 V1604G probably damaging Het
Olfr1299 T G 2: 111,664,242 N5K possibly damaging Het
Olfr139 A G 11: 74,045,100 L58P probably damaging Het
Olfr1505 G A 19: 13,919,862 V281I probably benign Het
Olfr1513 T C 14: 52,349,168 N293D probably damaging Het
Ormdl2 A G 10: 128,818,968 L125P possibly damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pde3a T A 6: 141,487,801 F803Y possibly damaging Het
Pnpla7 C T 2: 24,983,623 R214W probably damaging Het
Prtg T C 9: 72,906,238 V960A probably benign Het
Ptgdr T C 14: 44,853,401 E300G probably benign Het
Ptpru G T 4: 131,794,963 Y710* probably null Het
Pxdn T A 12: 29,999,196 Y620* probably null Het
Pycard T C 7: 127,993,625 D10G possibly damaging Het
Sh3d21 G T 4: 126,161,982 Q160K probably benign Het
Slc26a7 G A 4: 14,621,269 P39L probably benign Het
Snrnp200 T A 2: 127,227,008 Y936N probably damaging Het
Sox8 T C 17: 25,567,643 D362G possibly damaging Het
Tcp11 T G 17: 28,067,027 N538T probably damaging Het
Tmem132e A C 11: 82,434,840 E222A probably benign Het
Trpc7 T C 13: 56,789,789 E618G probably benign Het
Tsc2 G T 17: 24,614,366 Q695K probably benign Het
Txlnb C A 10: 17,843,004 L528M possibly damaging Het
Vmn1r176 A G 7: 23,835,453 Y92H probably benign Het
Vmn2r85 T A 10: 130,418,869 I649F probably damaging Het
Vwa8 T C 14: 78,933,832 probably null Het
Wrn A T 8: 33,324,246 I390N probably benign Het
Zfp493 T A 13: 67,786,857 C310S probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGCACATAGAGCAACAAATATGG -3'
(R):5'- GCCTTTCATTAGGGCTGAATCC -3'

Sequencing Primer
(F):5'- GAAGTCTTACCTTGTGGACAGTC -3'
(R):5'- GGCTGAATCCAGACTGATTTCC -3'
Posted On2020-07-28