Incidental Mutation 'R8262:Ptpru'
ID639848
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8262 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 131794963 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 710 (Y710*)
Ref Sequence ENSEMBL: ENSMUSP00000095472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]
Predicted Effect probably null
Transcript: ENSMUST00000030741
AA Change: Y782*
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: Y782*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably null
Transcript: ENSMUST00000097860
AA Change: Y710*
SMART Domains Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: Y710*

DomainStartEndE-ValueType
Pfam:MAM 1 116 4.1e-30 PFAM
IG 123 211 4.93e-3 SMART
FN3 213 296 3.79e-2 SMART
FN3 312 400 2.5e-2 SMART
FN3 416 504 3.62e-8 SMART
low complexity region 555 569 N/A INTRINSIC
low complexity region 595 605 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
Blast:PTPc 736 878 3e-49 BLAST
SCOP:d1jlna_ 790 886 9e-19 SMART
PDB:2C7S|A 797 878 7e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000105987
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,107,710 D358G possibly damaging Het
Adam26a A T 8: 43,569,141 C437* probably null Het
Arhgap10 A T 8: 77,310,839 C587S probably benign Het
Bank1 G A 3: 136,242,960 T285I probably benign Het
Bhlha15 C T 5: 144,191,439 S123L probably damaging Het
Cacul1 T C 19: 60,529,037 *305W probably null Het
Cep112 A C 11: 108,503,151 K365T probably damaging Het
Chrm1 T A 19: 8,679,089 L386Q probably damaging Het
Cnbp C A 6: 87,845,212 R110L probably damaging Het
Cntnap5a A T 1: 116,188,410 I541F possibly damaging Het
Enpp3 C T 10: 24,777,926 S711N probably damaging Het
Eps8 G T 6: 137,482,254 N750K probably benign Het
Fan1 G T 7: 64,373,306 N66K probably benign Het
Fbf1 G A 11: 116,154,019 T323I probably benign Het
Flg2 A T 3: 93,220,210 N2143I unknown Het
Fn3k A C 11: 121,448,918 T169P probably benign Het
Fubp1 T G 3: 152,220,719 I320R probably damaging Het
Gfpt2 A T 11: 49,823,780 E335D probably benign Het
Gm13762 T G 2: 88,973,208 S228R probably damaging Het
Gm17472 T C 6: 42,981,034 I79T probably benign Het
Gpr151 C A 18: 42,578,372 E414* probably null Het
Gpr179 G A 11: 97,336,157 S1724L probably benign Het
Gtf2h3 C A 5: 124,590,904 Y175* probably null Het
Hal T A 10: 93,492,507 I215N probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Htt A G 5: 34,895,960 T2546A probably benign Het
Ighv1-11 T C 12: 114,612,457 Y46C probably damaging Het
Lcn4 T C 2: 26,668,363 D170G probably benign Het
Lrch1 T A 14: 74,818,495 D306V probably damaging Het
Mtcl1 A C 17: 66,343,658 V1604G probably damaging Het
Olfr1299 T G 2: 111,664,242 N5K possibly damaging Het
Olfr139 A G 11: 74,045,100 L58P probably damaging Het
Olfr1505 G A 19: 13,919,862 V281I probably benign Het
Olfr1513 T C 14: 52,349,168 N293D probably damaging Het
Ormdl2 A G 10: 128,818,968 L125P possibly damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pde3a T A 6: 141,487,801 F803Y possibly damaging Het
Pnpla7 C T 2: 24,983,623 R214W probably damaging Het
Prtg T C 9: 72,906,238 V960A probably benign Het
Ptgdr T C 14: 44,853,401 E300G probably benign Het
Pxdn T A 12: 29,999,196 Y620* probably null Het
Pycard T C 7: 127,993,625 D10G possibly damaging Het
Sh3d21 G T 4: 126,161,982 Q160K probably benign Het
Slc26a7 G A 4: 14,621,269 P39L probably benign Het
Snrnp200 T A 2: 127,227,008 Y936N probably damaging Het
Sox8 T C 17: 25,567,643 D362G possibly damaging Het
Tcp11 T G 17: 28,067,027 N538T probably damaging Het
Tmem132e A C 11: 82,434,840 E222A probably benign Het
Trpc7 T C 13: 56,789,789 E618G probably benign Het
Tsc2 G T 17: 24,614,366 Q695K probably benign Het
Txlnb C A 10: 17,843,004 L528M possibly damaging Het
Vmn1r176 A G 7: 23,835,453 Y92H probably benign Het
Vmn2r85 T A 10: 130,418,869 I649F probably damaging Het
Vwa8 T C 14: 78,933,832 probably null Het
Wrn A T 8: 33,324,246 I390N probably benign Het
Zfp493 T A 13: 67,786,857 C310S probably damaging Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
R7736:Ptpru UTSW 4 131788382 missense probably damaging 1.00
R7960:Ptpru UTSW 4 131788509 missense probably benign 0.01
R8094:Ptpru UTSW 4 131793592 missense possibly damaging 0.88
R8276:Ptpru UTSW 4 131779173 missense probably damaging 1.00
R8377:Ptpru UTSW 4 131808335 missense probably damaging 1.00
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Z1177:Ptpru UTSW 4 131799706 missense probably benign 0.00
Z1177:Ptpru UTSW 4 131808262 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAGAATTTAATGCACACACTCG -3'
(R):5'- CTGCAGCACACTTAGGGAAG -3'

Sequencing Primer
(F):5'- ATGTCAGCAATTCCTCGGAG -3'
(R):5'- CAGCACACTTAGGGAAGATTCTG -3'
Posted On2020-07-28