Mutagenetix > Incidental Mutation

Incidental Mutation 'R8262:Enpp3'

639865

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R8262 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24777926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 711 (S711N)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169]

AlphaFold

Q6DYE8

Predicted Effect

probably damaging
Transcript: ENSMUST00000020169
AA Change: S711N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: S711N

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	C	6: 23,107,710	D358G	possibly damaging	Het
Adam26a	A	T	8: 43,569,141	C437*	probably null	Het
Arhgap10	A	T	8: 77,310,839	C587S	probably benign	Het
Bank1	G	A	3: 136,242,960	T285I	probably benign	Het
Bhlha15	C	T	5: 144,191,439	S123L	probably damaging	Het
Cacul1	T	C	19: 60,529,037	*305W	probably null	Het
Cep112	A	C	11: 108,503,151	K365T	probably damaging	Het
Chrm1	T	A	19: 8,679,089	L386Q	probably damaging	Het
Cnbp	C	A	6: 87,845,212	R110L	probably damaging	Het
Cntnap5a	A	T	1: 116,188,410	I541F	possibly damaging	Het
Dscaml1	T	G	9: 45,747,140		probably benign	Het
Eps8	G	T	6: 137,482,254	N750K	probably benign	Het
Fan1	G	T	7: 64,373,306	N66K	probably benign	Het
Fbf1	G	A	11: 116,154,019	T323I	probably benign	Het
Flg2	A	T	3: 93,220,210	N2143I	unknown	Het
Fn3k	A	C	11: 121,448,918	T169P	probably benign	Het
Fubp1	T	G	3: 152,220,719	I320R	probably damaging	Het
Gfpt2	A	T	11: 49,823,780	E335D	probably benign	Het
Gm13762	T	G	2: 88,973,208	S228R	probably damaging	Het
Gm17472	T	C	6: 42,981,034	I79T	probably benign	Het
Gpr151	C	A	18: 42,578,372	E414*	probably null	Het
Gpr179	G	A	11: 97,336,157	S1724L	probably benign	Het
Gtf2h3	C	A	5: 124,590,904	Y175*	probably null	Het
Hal	T	A	10: 93,492,507	I215N	probably damaging	Het
Htt	A	G	5: 34,895,960	T2546A	probably benign	Het
Ighv1-11	T	C	12: 114,612,457	Y46C	probably damaging	Het
Lcn4	T	C	2: 26,668,363	D170G	probably benign	Het
Lrch1	T	A	14: 74,818,495	D306V	probably damaging	Het
Mtcl1	A	C	17: 66,343,658	V1604G	probably damaging	Het
Olfr1299	T	G	2: 111,664,242	N5K	possibly damaging	Het
Olfr139	A	G	11: 74,045,100	L58P	probably damaging	Het
Olfr1505	G	A	19: 13,919,862	V281I	probably benign	Het
Olfr1513	T	C	14: 52,349,168	N293D	probably damaging	Het
Ormdl2	A	G	10: 128,818,968	L125P	possibly damaging	Het
Papd4	T	C	13: 93,174,489		probably benign	Het
Pcnx3	C	T	19: 5,665,384	G1946E	probably damaging	Het
Pde3a	T	A	6: 141,487,801	F803Y	possibly damaging	Het
Pnpla7	C	T	2: 24,983,623	R214W	probably damaging	Het
Prtg	T	C	9: 72,906,238	V960A	probably benign	Het
Ptgdr	T	C	14: 44,853,401	E300G	probably benign	Het
Ptpru	G	T	4: 131,794,963	Y710*	probably null	Het
Pxdn	T	A	12: 29,999,196	Y620*	probably null	Het
Pycard	T	C	7: 127,993,625	D10G	possibly damaging	Het
Sh3d21	G	T	4: 126,161,982	Q160K	probably benign	Het
Slc26a7	G	A	4: 14,621,269	P39L	probably benign	Het
Snrnp200	T	A	2: 127,227,008	Y936N	probably damaging	Het
Sox8	T	C	17: 25,567,643	D362G	possibly damaging	Het
Tcp11	T	G	17: 28,067,027	N538T	probably damaging	Het
Tmem132e	A	C	11: 82,434,840	E222A	probably benign	Het
Trpc7	T	C	13: 56,789,789	E618G	probably benign	Het
Tsc2	G	T	17: 24,614,366	Q695K	probably benign	Het
Txlnb	C	A	10: 17,843,004	L528M	possibly damaging	Het
Vmn1r176	A	G	7: 23,835,453	Y92H	probably benign	Het
Vmn2r85	T	A	10: 130,418,869	I649F	probably damaging	Het
Vwa8	T	C	14: 78,933,832		probably null	Het
Wrn	A	T	8: 33,324,246	I390N	probably benign	Het
Zfp493	T	A	13: 67,786,857	C310S	probably damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGTTTAGTTTGGCCAGCC -3'
(R):5'- ACAACTGGTATGTGACTCTGG -3'

Sequencing Primer
(F):5'- GCCTGACTGGACTACAAAGTTTG -3'
(R):5'- ATGTGACTCTGGCTGGTTTG -3'

Posted On

2020-07-28