Incidental Mutation 'R8262:Enpp3'
ID 639865
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
MMRRC Submission 067687-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R8262 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 24649712-24712093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24653824 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 711 (S711N)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169]
AlphaFold Q6DYE8
Predicted Effect probably damaging
Transcript: ENSMUST00000020169
AA Change: S711N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: S711N

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,107,709 (GRCm39) D358G possibly damaging Het
Adam26a A T 8: 44,022,178 (GRCm39) C437* probably null Het
Arhgap10 A T 8: 78,037,468 (GRCm39) C587S probably benign Het
Bank1 G A 3: 135,948,721 (GRCm39) T285I probably benign Het
Bhlha15 C T 5: 144,128,257 (GRCm39) S123L probably damaging Het
Cacul1 T C 19: 60,517,475 (GRCm39) *305W probably null Het
Cep112 A C 11: 108,393,977 (GRCm39) K365T probably damaging Het
Chrm1 T A 19: 8,656,453 (GRCm39) L386Q probably damaging Het
Cnbp C A 6: 87,822,194 (GRCm39) R110L probably damaging Het
Cntnap5a A T 1: 116,116,140 (GRCm39) I541F possibly damaging Het
Dscaml1 T G 9: 45,658,438 (GRCm39) probably benign Het
Eps8 G T 6: 137,459,252 (GRCm39) N750K probably benign Het
Fan1 G T 7: 64,023,054 (GRCm39) N66K probably benign Het
Fbf1 G A 11: 116,044,845 (GRCm39) T323I probably benign Het
Flg2 A T 3: 93,127,517 (GRCm39) N2143I unknown Het
Fn3k A C 11: 121,339,744 (GRCm39) T169P probably benign Het
Fubp1 T G 3: 151,926,356 (GRCm39) I320R probably damaging Het
Gfpt2 A T 11: 49,714,607 (GRCm39) E335D probably benign Het
Gm17472 T C 6: 42,957,968 (GRCm39) I79T probably benign Het
Gpr151 C A 18: 42,711,437 (GRCm39) E414* probably null Het
Gpr179 G A 11: 97,226,983 (GRCm39) S1724L probably benign Het
Gtf2h3 C A 5: 124,728,967 (GRCm39) Y175* probably null Het
Hal T A 10: 93,328,369 (GRCm39) I215N probably damaging Het
Htt A G 5: 35,053,304 (GRCm39) T2546A probably benign Het
Ighv1-11 T C 12: 114,576,077 (GRCm39) Y46C probably damaging Het
Lcn4 T C 2: 26,558,375 (GRCm39) D170G probably benign Het
Lrch1 T A 14: 75,055,935 (GRCm39) D306V probably damaging Het
Mtcl1 A C 17: 66,650,653 (GRCm39) V1604G probably damaging Het
Or10g3b T C 14: 52,586,625 (GRCm39) N293D probably damaging Het
Or3a10 A G 11: 73,935,926 (GRCm39) L58P probably damaging Het
Or4c108 T G 2: 88,803,552 (GRCm39) S228R probably damaging Het
Or4k49 T G 2: 111,494,587 (GRCm39) N5K possibly damaging Het
Or9i1b G A 19: 13,897,226 (GRCm39) V281I probably benign Het
Ormdl2 A G 10: 128,654,837 (GRCm39) L125P possibly damaging Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Pde3a T A 6: 141,433,527 (GRCm39) F803Y possibly damaging Het
Pnpla7 C T 2: 24,873,635 (GRCm39) R214W probably damaging Het
Prtg T C 9: 72,813,520 (GRCm39) V960A probably benign Het
Ptgdr T C 14: 45,090,858 (GRCm39) E300G probably benign Het
Ptpru G T 4: 131,522,274 (GRCm39) Y710* probably null Het
Pxdn T A 12: 30,049,195 (GRCm39) Y620* probably null Het
Pycard T C 7: 127,592,797 (GRCm39) D10G possibly damaging Het
Sh3d21 G T 4: 126,055,775 (GRCm39) Q160K probably benign Het
Slc26a7 G A 4: 14,621,269 (GRCm39) P39L probably benign Het
Snrnp200 T A 2: 127,068,928 (GRCm39) Y936N probably damaging Het
Sox8 T C 17: 25,786,617 (GRCm39) D362G possibly damaging Het
Tcp11 T G 17: 28,286,001 (GRCm39) N538T probably damaging Het
Tent2 T C 13: 93,310,997 (GRCm39) probably benign Het
Tmem132e A C 11: 82,325,666 (GRCm39) E222A probably benign Het
Trpc7 T C 13: 56,937,602 (GRCm39) E618G probably benign Het
Tsc2 G T 17: 24,833,340 (GRCm39) Q695K probably benign Het
Txlnb C A 10: 17,718,752 (GRCm39) L528M possibly damaging Het
Vmn1r176 A G 7: 23,534,878 (GRCm39) Y92H probably benign Het
Vmn2r85 T A 10: 130,254,738 (GRCm39) I649F probably damaging Het
Vwa8 T C 14: 79,171,272 (GRCm39) probably null Het
Wrn A T 8: 33,814,274 (GRCm39) I390N probably benign Het
Zfp493 T A 13: 67,934,976 (GRCm39) C310S probably damaging Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,663,670 (GRCm39) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,674,160 (GRCm39) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,650,805 (GRCm39) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,681,820 (GRCm39) nonsense probably null
IGL01642:Enpp3 APN 10 24,674,167 (GRCm39) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,667,923 (GRCm39) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,652,692 (GRCm39) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,649,900 (GRCm39) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,667,881 (GRCm39) splice site probably benign
IGL02517:Enpp3 APN 10 24,685,746 (GRCm39) splice site probably benign
IGL02956:Enpp3 APN 10 24,650,841 (GRCm39) splice site probably benign
R0017:Enpp3 UTSW 10 24,675,051 (GRCm39) splice site probably null
R0042:Enpp3 UTSW 10 24,650,722 (GRCm39) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24,652,767 (GRCm39) missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24,680,334 (GRCm39) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,696,495 (GRCm39) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,671,614 (GRCm39) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,660,851 (GRCm39) splice site probably benign
R1261:Enpp3 UTSW 10 24,650,832 (GRCm39) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,671,680 (GRCm39) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,654,687 (GRCm39) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,652,669 (GRCm39) nonsense probably null
R1966:Enpp3 UTSW 10 24,683,389 (GRCm39) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,652,776 (GRCm39) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,681,793 (GRCm39) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,652,770 (GRCm39) missense probably benign
R2410:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,707,630 (GRCm39) splice site probably null
R3896:Enpp3 UTSW 10 24,653,847 (GRCm39) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,669,487 (GRCm39) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,652,780 (GRCm39) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,649,825 (GRCm39) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,674,175 (GRCm39) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,683,436 (GRCm39) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,652,665 (GRCm39) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,685,814 (GRCm39) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,684,058 (GRCm39) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,654,719 (GRCm39) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,650,740 (GRCm39) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,663,750 (GRCm39) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,684,089 (GRCm39) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,653,855 (GRCm39) missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24,683,351 (GRCm39) missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24,685,768 (GRCm39) missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24,684,064 (GRCm39) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,702,093 (GRCm39) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,649,945 (GRCm39) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,652,782 (GRCm39) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,693,742 (GRCm39) missense unknown
R7487:Enpp3 UTSW 10 24,681,821 (GRCm39) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,674,072 (GRCm39) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24,660,739 (GRCm39) nonsense probably null
R7962:Enpp3 UTSW 10 24,660,752 (GRCm39) missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24,654,717 (GRCm39) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,685,777 (GRCm39) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,700,827 (GRCm39) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,702,139 (GRCm39) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,696,513 (GRCm39) missense probably benign 0.12
R9047:Enpp3 UTSW 10 24,674,172 (GRCm39) missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24,671,702 (GRCm39) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,702,078 (GRCm39) missense possibly damaging 0.67
R9194:Enpp3 UTSW 10 24,675,092 (GRCm39) missense possibly damaging 0.90
R9224:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R9244:Enpp3 UTSW 10 24,654,689 (GRCm39) missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R9644:Enpp3 UTSW 10 24,685,801 (GRCm39) missense probably damaging 0.98
R9658:Enpp3 UTSW 10 24,649,802 (GRCm39) makesense probably null
X0026:Enpp3 UTSW 10 24,702,140 (GRCm39) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,663,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTTAGTTTGGCCAGCC -3'
(R):5'- ACAACTGGTATGTGACTCTGG -3'

Sequencing Primer
(F):5'- GCCTGACTGGACTACAAAGTTTG -3'
(R):5'- ATGTGACTCTGGCTGGTTTG -3'
Posted On 2020-07-28